WBP2 cDNA ORF Clone, Canine, untagged

Cat: DG70203-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All WBP2 Reagents
CRO Services
Product recommended

All WBP2 Reagents
WBP2 cDNA ORF Clone, Canine, untagged General Information
Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
786 bp
Description
Full length Clone DNA of Canine WW domain binding protein 2.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

WBP2 Background Information
Full Name
WW domain binding protein 2

WBP2 cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
WBP2 cDNA ORF Clone in Cloning Vector, Canine DG70203-U
WBP2 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70203-ACGLN
WBP2 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70203-ACG
WBP2 cDNA ORF Clone, Canine, N-GFPSpark® tag DG70203-ANG
WBP2 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70203-ACR
WBP2 cDNA ORF Clone, Canine, N-OFPSpark® tag DG70203-ANR
WBP2 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70203-CF
WBP2 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70203-NF
WBP2 cDNA ORF Clone, Canine, C-His tag DG70203-CH
WBP2 cDNA ORF Clone, Canine, N-His tag DG70203-NH
WBP2 cDNA ORF Clone, Canine, C-HA tag DG70203-CY
WBP2 cDNA ORF Clone, Canine, N-HA tag DG70203-NY
WBP2 cDNA ORF Clone, Canine, C-Myc tag DG70203-CM
WBP2 cDNA ORF Clone, Canine, N-Myc tag DG70203-NM

WBP2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
WBP2 cDNA ORF Clone in Cloning Vector, Mouse MG52646-U
WBP2 cDNA ORF Clone, Mouse, untagged MG52646-UT
WBP2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52646-ACG
WBP2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52646-ACGLN
WBP2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52646-ANG
WBP2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52646-ACR
WBP2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52646-ANR
WBP2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52646-CF
WBP2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52646-NF
WBP2 cDNA ORF Clone, Mouse, C-His tag MG52646-CH
WBP2 cDNA ORF Clone, Mouse, N-His tag MG52646-NH
WBP2 cDNA ORF Clone, Mouse, C-HA tag MG52646-CY
WBP2 cDNA ORF Clone, Mouse, N-HA tag MG52646-NY
WBP2 cDNA ORF Clone, Mouse, C-Myc tag MG52646-CM
WBP2 cDNA ORF Clone, Mouse, N-Myc tag MG52646-NM
WBP2 qPCR Primer Pairs, Mouse MP202517

WBP2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
WBP2 cDNA ORF Clone in Cloning Vector, Human HG16656-U
WBP2 cDNA ORF Clone, Human, untagged HG16656-UT
WBP2 cDNA ORF Clone, Human, C-GFPSpark® tag HG16656-ACG
WBP2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16656-ACGLN
WBP2 cDNA ORF Clone, Human, N-GFPSpark® tag HG16656-ANG
WBP2 cDNA ORF Clone, Human, C-OFPSpark® tag HG16656-ACR
WBP2 cDNA ORF Clone, Human, N-OFPSpark® tag HG16656-ANR
WBP2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16656-CF
WBP2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16656-NF
WBP2 cDNA ORF Clone, Human, C-His tag HG16656-CH
WBP2 cDNA ORF Clone, Human, N-His tag HG16656-NH
WBP2 cDNA ORF Clone, Human, C-HA tag HG16656-CY
WBP2 cDNA ORF Clone, Human, N-HA tag HG16656-NY
WBP2 cDNA ORF Clone, Human, C-Myc tag HG16656-CM
WBP2 cDNA ORF Clone, Human, N-Myc tag HG16656-NM
info info
添加购物车成功! 添加购物车失败!