VIMP cDNA ORF Clone, Canine, C-DDK (Flag®) tag

Cat: DG70198-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All VIMP Reagents
CRO Services
Product recommended

All VIMP Reagents
VIMP cDNA ORF Clone, Canine, C-DDK (Flag®) tag General Information
Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
567 bp
Description
Full length Clone DNA of Canine VCP-interacting membrane protein with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

VIMP Background Information
Full Name
VCP-interacting membrane protein

VIMP cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
VIMP cDNA ORF Clone in Cloning Vector, Canine DG70198-U
VIMP cDNA ORF Clone, Canine, untagged DG70198-UT
VIMP cDNA ORF Clone, Canine, C-GFPSpark® tag DG70198-ACG
VIMP Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70198-ACGLN
VIMP cDNA ORF Clone, Canine, N-GFPSpark® tag DG70198-ANG
VIMP cDNA ORF Clone, Canine, C-OFPSpark® tag DG70198-ACR
VIMP cDNA ORF Clone, Canine, N-OFPSpark® tag DG70198-ANR
VIMP cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70198-NF
VIMP cDNA ORF Clone, Canine, C-His tag DG70198-CH
VIMP cDNA ORF Clone, Canine, N-His tag DG70198-NH
VIMP cDNA ORF Clone, Canine, C-HA tag DG70198-CY
VIMP cDNA ORF Clone, Canine, N-HA tag DG70198-NY
VIMP cDNA ORF Clone, Canine, C-Myc tag DG70198-CM
VIMP cDNA ORF Clone, Canine, N-Myc tag DG70198-NM

VIMP cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
VIMP cDNA ORF Clone in Cloning Vector, Rat RG85994-U
VIMP Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG85994-ACGLN

VIMP cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
VIMP cDNA ORF Clone in Cloning Vector, Mouse MG52556-G
VIMP cDNA ORF Clone, Mouse, untagged MG52556-UT
VIMP Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52556-ACGLN
VIMP cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52556-ACG
VIMP cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52556-ANG
VIMP cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52556-ACR
VIMP cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52556-ANR
VIMP cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52556-CF
VIMP cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52556-NF
VIMP cDNA ORF Clone, Mouse, C-His tag MG52556-CH
VIMP cDNA ORF Clone, Mouse, N-His tag MG52556-NH
VIMP cDNA ORF Clone, Mouse, C-HA tag MG52556-CY
VIMP cDNA ORF Clone, Mouse, N-HA tag MG52556-NY
VIMP cDNA ORF Clone, Mouse, C-Myc tag MG52556-CM
VIMP cDNA ORF Clone, Mouse, N-Myc tag MG52556-NM
VIMP qPCR Primer Pairs, Mouse MP202429

VIMP cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
VIMP cDNA ORF Clone in Cloning Vector, Human HG17116-U
VIMP cDNA ORF Clone, Human, untagged HG17116-UT
VIMP Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17116-ACGLN
VIMP cDNA ORF Clone, Human, C-GFPSpark® tag HG17116-ACG
VIMP cDNA ORF Clone, Human, N-GFPSpark® tag HG17116-ANG
VIMP cDNA ORF Clone, Human, C-OFPSpark® tag HG17116-ACR
VIMP cDNA ORF Clone, Human, N-OFPSpark® tag HG17116-ANR
VIMP cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17116-CF
VIMP cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17116-NF
VIMP cDNA ORF Clone, Human, C-His tag HG17116-CH
VIMP cDNA ORF Clone, Human, N-His tag HG17116-NH
VIMP cDNA ORF Clone, Human, C-HA tag HG17116-CY
VIMP cDNA ORF Clone, Human, N-HA tag HG17116-NY
VIMP cDNA ORF Clone, Human, C-Myc tag HG17116-CM
VIMP cDNA ORF Clone, Human, N-Myc tag HG17116-NM
info info
添加购物车成功! 添加购物车失败!