TRAPPC6B cDNA ORF Clone, Canine, C-DDK (Flag®) tag

Cat: DG70176-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TRAPPC6B Reagents
CRO Services
Product recommended

All TRAPPC6B Reagents
TRAPPC6B cDNA ORF Clone, Canine, C-DDK (Flag®) tag General Information
Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
477 bp
Description
Full length Clone DNA of Canine trafficking protein particle complex 6B with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TRAPPC6B Background Information
Full Name
trafficking protein particle complex 6B

TRAPPC6B cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
TRAPPC6B cDNA ORF Clone in Cloning Vector, Canine DG70176-U
TRAPPC6B cDNA ORF Clone, Canine, untagged DG70176-UT
TRAPPC6B Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70176-ACGLN
TRAPPC6B cDNA ORF Clone, Canine, C-GFPSpark® tag DG70176-ACG
TRAPPC6B cDNA ORF Clone, Canine, N-GFPSpark® tag DG70176-ANG
TRAPPC6B cDNA ORF Clone, Canine, C-OFPSpark® tag DG70176-ACR
TRAPPC6B cDNA ORF Clone, Canine, N-OFPSpark® tag DG70176-ANR
TRAPPC6B cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70176-NF
TRAPPC6B cDNA ORF Clone, Canine, C-His tag DG70176-CH
TRAPPC6B cDNA ORF Clone, Canine, N-His tag DG70176-NH
TRAPPC6B cDNA ORF Clone, Canine, C-HA tag DG70176-CY
TRAPPC6B cDNA ORF Clone, Canine, N-HA tag DG70176-NY
TRAPPC6B cDNA ORF Clone, Canine, C-Myc tag DG70176-CM
TRAPPC6B cDNA ORF Clone, Canine, N-Myc tag DG70176-NM

TRAPPC6B cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TRAPPC6B cDNA ORF Clone in Cloning Vector, Mouse MG5A6488-U
TRAPPC6B cDNA ORF Clone, Mouse, untagged MG5A6488-UT
TRAPPC6B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A6488-ACGLN
TRAPPC6B cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A6488-ACG
TRAPPC6B cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A6488-ANG
TRAPPC6B cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A6488-ACR
TRAPPC6B cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A6488-ANR
TRAPPC6B cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A6488-CF
TRAPPC6B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A6488-NF
TRAPPC6B cDNA ORF Clone, Mouse, C-His tag MG5A6488-CH
TRAPPC6B cDNA ORF Clone, Mouse, N-His tag MG5A6488-NH
TRAPPC6B cDNA ORF Clone, Mouse, C-HA tag MG5A6488-CY
TRAPPC6B cDNA ORF Clone, Mouse, N-HA tag MG5A6488-NY
TRAPPC6B cDNA ORF Clone, Mouse, C-Myc tag MG5A6488-CM
TRAPPC6B cDNA ORF Clone, Mouse, N-Myc tag MG5A6488-NM

TRAPPC6B cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TRAPPC6B cDNA ORF Clone in Cloning Vector, Human HG23613-U
TRAPPC6B cDNA ORF Clone, Human, untagged HG23613-UT
TRAPPC6B cDNA ORF Clone, Human, C-GFPSpark® tag HG23613-ACG
TRAPPC6B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG23613-ACGLN
TRAPPC6B cDNA ORF Clone, Human, N-GFPSpark® tag HG23613-ANG
TRAPPC6B cDNA ORF Clone, Human, C-OFPSpark® tag HG23613-ACR
TRAPPC6B cDNA ORF Clone, Human, N-OFPSpark® tag HG23613-ANR
TRAPPC6B cDNA ORF Clone, Human, C-DDK (Flag®) tag HG23613-CF
TRAPPC6B cDNA ORF Clone, Human, N-DDK (Flag®) tag HG23613-NF
TRAPPC6B cDNA ORF Clone, Human, C-His tag HG23613-CH
TRAPPC6B cDNA ORF Clone, Human, N-His tag HG23613-NH
TRAPPC6B cDNA ORF Clone, Human, C-HA tag HG23613-CY
TRAPPC6B cDNA ORF Clone, Human, N-HA tag HG23613-NY
TRAPPC6B cDNA ORF Clone, Human, C-Myc tag HG23613-CM
TRAPPC6B cDNA ORF Clone, Human, N-Myc tag HG23613-NM
info info
添加购物车成功! 添加购物车失败!