alk5 cDNA ORF Clone, Canine, untagged

Cat: DG70047-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All alk5 Reagents
CRO Services
Product recommended

All alk5 Reagents
alk5 cDNA ORF Clone, Canine, untagged General Information
Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
1305 bp
Description
Full length Clone DNA of Canine transforming growth factor, beta receptor 1.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

alk5 Background Information

Transforming growth factor, beta receptor I, also known as Transforming growth factor-beta receptor type I , Serine / threonine-protein kinase receptor R4, Activin receptor-like kinase 5, SKR4, ALK-5, and TGFBR1, is a single-pass type I membrane protein which belongs to the protein kinase superfamily and TGFB receptor subfamily. TGFBR1 / ALK-5 is found in all tissues examined. It is most abundant in placenta and least abundant in brain and heart. TGF-beta functions as a tumor suppressor by inhibiting the cell cycle in the G1 phase. Administration of TGF-beta is able to protect against mammary tumor development in transgenic mouse models in vivo. Disruption of the TGF-beta/SMAD pathway has been implicated in a variety of human cancers, with the majority of colon and gastric cancers being caused by an inactivating mutation of TGF-beta RII. On ligand binding, TGFBR1 / ALK-5 forms a receptor complex consisting of two type I I and two type I transmembrane serine/threonine kinases. Type II receptors phosphorylate and activate type I receptors which auto-phosphorylate, then bind and activate SMAD transcriptional regulators. TGF-beta signaling via TGFBR1 / ALK-5 is not required in myocardial cells during mammalian cardiac development, but plays an irreplaceable cell-autonomous role regulating cellular communication, differentiation and proliferation in endocardial and epicardial cells. Defects in TGFBR1 / ALK-5 are the cause of Loeys-Dietz syndrome type 1A (LDS1A), Loeys-Dietz syndrome type 2A (LDS2A), and aortic aneurysm familial thoracic type 5 (AAT5).

Full Name
transforming growth factor, beta receptor 1
References
  • Seki T, et al. (2006) Nonoverlapping expression patterns of ALK1 and ALK5 reveal distinct roles of each receptor in vascular development. Lab Invest. 86(2): 116-29. et al.
  • Piek E, et al. (1999) TGF-(beta) type I receptor/ALK-5 and Smad proteins mediate epithelial to mesenchymal transdifferentiation in NMuMG breast epithelial cells. J Cell Sci. 112 (24): 4557-68. et al.
  • Dudas M, et al. (2004) Tgf-beta3-induced palatal fusion is mediated by Alk-5/Smad pathway. Dev Biol. 266(1): 96-108.
  • alk5 cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    alk5 cDNA ORF Clone in Cloning Vector, Canine DG70047-G
    alk5 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70047-ACG
    alk5 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70047-ACGLN
    alk5 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70047-ACR
    alk5 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70047-CF
    alk5 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70047-NF
    alk5 cDNA ORF Clone, Canine, C-His tag DG70047-CH
    alk5 cDNA ORF Clone, Canine, N-His tag DG70047-NH
    alk5 cDNA ORF Clone, Canine, C-HA tag DG70047-CY
    alk5 cDNA ORF Clone, Canine, N-HA tag DG70047-NY
    alk5 cDNA ORF Clone, Canine, C-Myc tag DG70047-CM
    alk5 cDNA ORF Clone, Canine, N-Myc tag DG70047-NM

    alk5 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    alk5 cDNA ORF Clone in Cloning Vector, Mouse MG50238-M
    alk5 cDNA ORF Clone, Mouse, untagged MG50238-UT
    alk5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50238-ACGLN
    alk5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50238-ACG
    alk5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50238-ACR
    alk5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50238-CF
    alk5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50238-NF
    alk5 cDNA ORF Clone, Mouse, C-His tag MG50238-CH
    alk5 cDNA ORF Clone, Mouse, N-His tag MG50238-NH
    alk5 cDNA ORF Clone, Mouse, C-HA tag MG50238-CY
    alk5 cDNA ORF Clone, Mouse, N-HA tag MG50238-NY
    alk5 cDNA ORF Clone, Mouse, C-Myc tag MG50238-CM
    alk5 cDNA ORF Clone, Mouse, N-Myc tag MG50238-NM
    alk5 qPCR Primer Pairs, Mouse MP200264

    alk5 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    alk5 cDNA ORF Clone in Cloning Vector, Human HG10459-M
    alk5 cDNA ORF Clone, Human, untagged HG10459-UT
    alk5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10459-ACGLN
    alk5 cDNA ORF Clone, Human, C-GFPSpark® tag HG10459-ACG
    alk5 cDNA ORF Clone, Human, C-OFPSpark® tag HG10459-ACR
    alk5 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10459-CF
    alk5 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10459-NF
    alk5 cDNA ORF Clone, Human, C-His tag HG10459-CH
    alk5 cDNA ORF Clone, Human, N-His tag HG10459-NH
    alk5 cDNA ORF Clone, Human, C-HA tag HG10459-CY
    alk5 cDNA ORF Clone, Human, N-HA tag HG10459-NY
    alk5 cDNA ORF Clone, Human, C-Myc tag HG10459-CM
    alk5 cDNA ORF Clone, Human, N-Myc tag HG10459-NM
    alk5 qPCR Primer Pairs, Human HP100487
    info info
    添加购物车成功! 添加购物车失败!