TCEAL1 cDNA ORF Clone, Canine, C-DDK (Flag®) tag

Cat: DG70223-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All TCEAL1 Reagents
CRO Services
Product recommended

All TCEAL1 Reagents
TCEAL1 cDNA ORF Clone, Canine, C-DDK (Flag®) tag General Information
Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
480 bp
Description
Full length Clone DNA of Canine transcription elongation factor A (SII)-like 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TCEAL1 Background Information
Full Name
transcription elongation factor A (SII)-like 1

TCEAL1 cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
TCEAL1 cDNA ORF Clone in Cloning Vector, Canine DG70223-U
TCEAL1 cDNA ORF Clone, Canine, untagged DG70223-UT
TCEAL1 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70223-ACGLN
TCEAL1 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70223-ACG
TCEAL1 cDNA ORF Clone, Canine, N-GFPSpark® tag DG70223-ANG
TCEAL1 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70223-ACR
TCEAL1 cDNA ORF Clone, Canine, N-OFPSpark® tag DG70223-ANR
TCEAL1 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70223-NF
TCEAL1 cDNA ORF Clone, Canine, C-His tag DG70223-CH
TCEAL1 cDNA ORF Clone, Canine, N-His tag DG70223-NH
TCEAL1 cDNA ORF Clone, Canine, C-HA tag DG70223-CY
TCEAL1 cDNA ORF Clone, Canine, N-HA tag DG70223-NY
TCEAL1 cDNA ORF Clone, Canine, C-Myc tag DG70223-CM
TCEAL1 cDNA ORF Clone, Canine, N-Myc tag DG70223-NM

TCEAL1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TCEAL1 cDNA ORF Clone in Cloning Vector, Mouse MG53216-G
TCEAL1 cDNA ORF Clone, Mouse, untagged MG53216-UT
TCEAL1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53216-ACGLN
TCEAL1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53216-ACG
TCEAL1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53216-ANG
TCEAL1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53216-ACR
TCEAL1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53216-ANR
TCEAL1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53216-CF
TCEAL1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53216-NF
TCEAL1 cDNA ORF Clone, Mouse, C-His tag MG53216-CH
TCEAL1 cDNA ORF Clone, Mouse, N-His tag MG53216-NH
TCEAL1 cDNA ORF Clone, Mouse, C-HA tag MG53216-CY
TCEAL1 cDNA ORF Clone, Mouse, N-HA tag MG53216-NY
TCEAL1 cDNA ORF Clone, Mouse, C-Myc tag MG53216-CM
TCEAL1 cDNA ORF Clone, Mouse, N-Myc tag MG53216-NM

TCEAL1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TCEAL1 cDNA ORF Clone, Human, untagged HG20378-UT
info info
添加购物车成功! 添加购物车失败!