Quick Order

Canine TCEAL1 ORF mammalian expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Canine TCEAL1 cDNA Clone Product Information
NCBI RefSeq:XM_538121.4
RefSeq ORF Size:480bp
cDNA Description:Full length Clone DNA of Canis lupus familiaris transcription elongation factor A (SII)-like 1 with C terminal His tag.
Gene Synonym:TCEAL1
Species:Canine
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Size / Price
Catalog: DG70223-CH
List Price:   (Save )
Price:      [How to order]
Availability
 Shipping instructions
Images
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"