SRSF3 cDNA ORF Clone, Canine, C-DDK (Flag®) tag

Cat: DG70218-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SRSF3 Reagents
CRO Services
Product recommended

All SRSF3 Reagents
SRSF3 cDNA ORF Clone, Canine, C-DDK (Flag®) tag General Information
Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
495 bp
Description
Full length Clone DNA of Canine serine/arginine-rich splicing factor 3 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SRSF3 Background Information
Full Name
serine/arginine-rich splicing factor 3

SRSF3 cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
SRSF3 cDNA ORF Clone in Cloning Vector, Canine DG70218-U
SRSF3 cDNA ORF Clone, Canine, untagged DG70218-UT
SRSF3 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70218-ACGLN
SRSF3 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70218-ACG
SRSF3 cDNA ORF Clone, Canine, N-GFPSpark® tag DG70218-ANG
SRSF3 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70218-ACR
SRSF3 cDNA ORF Clone, Canine, N-OFPSpark® tag DG70218-ANR
SRSF3 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70218-NF
SRSF3 cDNA ORF Clone, Canine, C-His tag DG70218-CH
SRSF3 cDNA ORF Clone, Canine, N-His tag DG70218-NH
SRSF3 cDNA ORF Clone, Canine, C-HA tag DG70218-CY
SRSF3 cDNA ORF Clone, Canine, N-HA tag DG70218-NY
SRSF3 cDNA ORF Clone, Canine, C-Myc tag DG70218-CM
SRSF3 cDNA ORF Clone, Canine, N-Myc tag DG70218-NM

SRSF3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SRSF3 cDNA ORF Clone in Cloning Vector, Rat RG80658-U
SRSF3 cDNA ORF Clone, Rat, untagged RG80658-UT
SRSF3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80658-ACGLN
SRSF3 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80658-ACG
SRSF3 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80658-ANG
SRSF3 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80658-ACR
SRSF3 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80658-ANR
SRSF3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80658-CF
SRSF3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80658-NF
SRSF3 cDNA ORF Clone, Rat, C-His tag RG80658-CH
SRSF3 cDNA ORF Clone, Rat, N-His tag RG80658-NH
SRSF3 cDNA ORF Clone, Rat, C-HA tag RG80658-CY
SRSF3 cDNA ORF Clone, Rat, N-HA tag RG80658-NY
SRSF3 cDNA ORF Clone, Rat, C-Myc tag RG80658-CM
SRSF3 cDNA ORF Clone, Rat, N-Myc tag RG80658-NM
SRSF3 qPCR Primer Pairs, Rat RP300622

SRSF3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SRSF3 cDNA ORF Clone in Cloning Vector, Mouse MG51336-U
SRSF3 cDNA ORF Clone, Mouse, untagged MG51336-UT
SRSF3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51336-ACG
SRSF3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51336-ACGLN
SRSF3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51336-ANG
SRSF3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51336-ACR
SRSF3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51336-ANR
SRSF3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51336-CF
SRSF3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51336-NF
SRSF3 cDNA ORF Clone, Mouse, C-His tag MG51336-CH
SRSF3 cDNA ORF Clone, Mouse, N-His tag MG51336-NH
SRSF3 cDNA ORF Clone, Mouse, C-HA tag MG51336-CY
SRSF3 cDNA ORF Clone, Mouse, N-HA tag MG51336-NY
SRSF3 cDNA ORF Clone, Mouse, C-Myc tag MG51336-CM
SRSF3 cDNA ORF Clone, Mouse, N-Myc tag MG51336-NM
SRSF3 qPCR Primer Pairs, Mouse MP201213

SRSF3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SRSF3 cDNA ORF Clone in Cloning Vector, Human HG18472-U
SRSF3 cDNA ORF Clone, Human, untagged HG18472-UT
SRSF3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG18472-ACGLN
SRSF3 cDNA ORF Clone, Human, C-GFPSpark® tag HG18472-ACG
SRSF3 cDNA ORF Clone, Human, N-GFPSpark® tag HG18472-ANG
SRSF3 cDNA ORF Clone, Human, C-OFPSpark® tag HG18472-ACR
SRSF3 cDNA ORF Clone, Human, N-OFPSpark® tag HG18472-ANR
SRSF3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG18472-CF
SRSF3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG18472-NF
SRSF3 cDNA ORF Clone, Human, C-His tag HG18472-CH
SRSF3 cDNA ORF Clone, Human, N-His tag HG18472-NH
SRSF3 cDNA ORF Clone, Human, C-HA tag HG18472-CY
SRSF3 cDNA ORF Clone, Human, N-HA tag HG18472-NY
SRSF3 cDNA ORF Clone, Human, C-Myc tag HG18472-CM
SRSF3 cDNA ORF Clone, Human, N-Myc tag HG18472-NM
info info
添加购物车成功! 添加购物车失败!