SPARCL1 cDNA ORF Clone, Canine, untagged

Cat: DG70239-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SPARCL1 Reagents
CRO Services
Product recommended

All SPARCL1 Reagents
SPARCL1 cDNA ORF Clone, Canine, untagged General Information
Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
2004 bp
Description
Full length Clone DNA of Canine SPARC-like 1 (hevin).
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SPARCL1 Background Information

SPARC-like protein 1 (SPARCL1; also known as SC1, high endothelial venule protein, or hevin) is an extracellular matrix-associated, secreted glycoprotein belonging to the secreted protein acidic and rich in cysteine (SPARC) family of matricellular proteins. It contains three conserved structural domains that are implicated in the regulation of cell adhesion, migration, and proliferation. SPARCL1 is expressed during embryogenesis and tissue remodeling and is especially prominent in brain and vasculature. Its down-regulation in a number of cancers and the possibility of its functional compensation by SPARC has led to recent interest in hevin as a tumor suppressor and regulator of angiogenesis. SPARCL1 has antiadhesive properties, and loss of SPARCL1 expression is associated with increased proliferative activity and cell cycle progression. It is suggested that it may influence multiple cellular processes during distinct stages of brain development and function. In addition, SPARCL1 can influence the function of astroglial cells in the developing and mature central nervous system (CNS).

Full Name
SPARC like 1
References
  • Sullivan MM, et al. (2004) Hevin/SC1, a matricellular glycoprotein and potential tumor-suppressor of the SPARC/BM-40/Osteonectin family. Int J Biochem Cell Biol. 36(6): 991-6.
  • Esposito I, et al. (2007) Tumor-suppressor function of SPARC-like protein 1/Hevin in pancreatic cancer. Neoplasia. 9(1): 8-17.
  • Weimer JM, et al. (2008) A BAC transgenic mouse model to analyze the function of astroglial SPARCL1 (SC1) in the central nervous system. Glia. 56(9): 935-41.
  • SPARCL1 cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    SPARCL1 cDNA ORF Clone in Cloning Vector, Canine DG70239-U
    SPARCL1 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70239-ACGLN
    SPARCL1 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70239-ACG
    SPARCL1 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70239-ACR
    SPARCL1 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70239-CF
    SPARCL1 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70239-NF
    SPARCL1 cDNA ORF Clone, Canine, C-His tag DG70239-CH
    SPARCL1 cDNA ORF Clone, Canine, N-His tag DG70239-NH
    SPARCL1 cDNA ORF Clone, Canine, C-HA tag DG70239-CY
    SPARCL1 cDNA ORF Clone, Canine, N-HA tag DG70239-NY
    SPARCL1 cDNA ORF Clone, Canine, C-Myc tag DG70239-CM
    SPARCL1 cDNA ORF Clone, Canine, N-Myc tag DG70239-NM

    SPARCL1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    SPARCL1 cDNA ORF Clone in Cloning Vector, Rat RG84133-U
    SPARCL1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG84133-ACGLN

    SPARCL1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    SPARCL1 cDNA ORF Clone in Cloning Vector, Mouse MG50544-M
    SPARCL1 cDNA ORF Clone, Mouse, untagged MG50544-UT
    SPARCL1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50544-ACGLN
    SPARCL1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50544-ACG
    SPARCL1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50544-ACR
    SPARCL1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50544-CF
    SPARCL1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50544-NF
    SPARCL1 cDNA ORF Clone, Mouse, C-His tag MG50544-CH
    SPARCL1 cDNA ORF Clone, Mouse, N-His tag MG50544-NH
    SPARCL1 cDNA ORF Clone, Mouse, C-HA tag MG50544-CY
    SPARCL1 cDNA ORF Clone, Mouse, N-HA tag MG50544-NY
    SPARCL1 cDNA ORF Clone, Mouse, C-Myc tag MG50544-CM
    SPARCL1 cDNA ORF Clone, Mouse, N-Myc tag MG50544-NM
    SPARCL1 qPCR Primer Pairs, Mouse MP200536

    SPARCL1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    SPARCL1 cDNA ORF Clone in Cloning Vector, Human HG10046-M
    SPARCL1 cDNA ORF Clone, Human, untagged HG10046-UT
    SPARCL1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10046-ACG
    SPARCL1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10046-ACGLN
    SPARCL1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10046-ACR
    SPARCL1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10046-CF
    SPARCL1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10046-NF
    SPARCL1 cDNA ORF Clone, Human, C-His tag HG10046-CH
    SPARCL1 cDNA ORF Clone, Human, N-His tag HG10046-NH
    SPARCL1 cDNA ORF Clone, Human, C-HA tag HG10046-CY
    SPARCL1 cDNA ORF Clone, Human, N-HA tag HG10046-NY
    SPARCL1 cDNA ORF Clone, Human, C-Myc tag HG10046-CM
    SPARCL1 cDNA ORF Clone, Human, N-Myc tag HG10046-NM
    SPARCL1 qPCR Primer Pairs, Human HP100101
    info info
    添加购物车成功! 添加购物车失败!