Quick Order

Text Size:AAA

Canine SNAP25 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Canine SNAP25 cDNA Clone Product Information
NCBI RefSeq:XM_005634794.1
RefSeq ORF Size:621bp
cDNA Description:Full length Clone DNA of Canis lupus familiaris synaptosomal-associated protein, 25kDa.
Gene Synonym:SNAP25
Species:Canine
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Synaptosomal-associated protein 25, also known as Super protein, Synaptosomal-associated 25 kDa protein, SNAP25 and SNAP, is a cytoplasm and cell membrane protein which belongs to the SNAP-25 family. SNAP25 / SUP contains 2 t-SNARE coiled-coil homology domains. SNAP25 / SUP is a membrane bound protein anchored to the cytosolic face of membranes via palmitoyl side chains in the middle of the molecule. SNAP25 / SUP protein is a component of the SNARE complex, which is proposed to account for the specificity of membrane fusion and to directly execute fusion by forming a tight complex that brings the synaptic vesicle and plasma membranes together. SNAP25 / SUP is a Q-SNARE protein contributing two α-helices in the formation of the exocytotic fusion complex in neurons where it assembles with syntaxin-1 and synaptobrevin. SNAP25 / SUP is involved in the molecular regulation of neurotransmitter release. It may play an important role in the synaptic function of specific neuronal systems. SNAP25 / SUP associates with proteins involved in vesicle docking and membrane fusion. SNAP25 / SUP regulates plasma membrane recycling through its interaction with CENPF. SNAP25 / SUP inhibits P/Q- and L-type voltage-gated calcium channels located presynaptically and interacts with the synaptotagmin C2B domain in Ca2+-independent fashion. In glutamatergic synapses SNAP25 / SUP decreases the Ca2+ responsiveness, while it is naturally absent in GABAergic synapses.

References
  • Hodel A ,et al.,1998, Int. J. Biochem. Cell Biol. 30 (10): 1069-73.
  • Sudhof TC, et al.,2002, Nat Rev Neurosci 3 (8): 641-653.
  • Chapman ER et al.,2002, Nat. Rev. Mol. Cell Biol. 3(7): 498-508.
  • Chen X., et al., 2002, Neuron 33:397-409.
  • Huang Q., et al., 2008, FEBS Lett. 582:1431-1436.
  • Size / Price
    Catalog: DG70182-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"