SELT cDNA ORF Clone, Canine, C-DDK (Flag®) tag

Cat: DG70202-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SELT Reagents
CRO Services
Product recommended

All SELT Reagents
SELT cDNA ORF Clone, Canine, C-DDK (Flag®) tag General Information
Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
588 bp
Description
Full length Clone DNA of Canine selenoprotein T with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SELT cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
SELT cDNA ORF Clone in Cloning Vector, Canine DG70202-U
SELT cDNA ORF Clone, Canine, untagged DG70202-UT
SELT cDNA ORF Clone, Canine, C-GFPSpark® tag DG70202-ACG
SELT Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70202-ACGLN
SELT cDNA ORF Clone, Canine, C-OFPSpark® tag DG70202-ACR
SELT cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70202-NF
SELT cDNA ORF Clone, Canine, C-His tag DG70202-CH
SELT cDNA ORF Clone, Canine, N-His tag DG70202-NH
SELT cDNA ORF Clone, Canine, C-HA tag DG70202-CY
SELT cDNA ORF Clone, Canine, N-HA tag DG70202-NY
SELT cDNA ORF Clone, Canine, C-Myc tag DG70202-CM
SELT cDNA ORF Clone, Canine, N-Myc tag DG70202-NM

SELT cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SELT cDNA ORF Clone in Cloning Vector, Rat RG81275-U
SELT cDNA ORF Clone, Rat, untagged RG81275-UT
SELT cDNA ORF Clone, Rat, C-GFPSpark® tag RG81275-ACG
SELT Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81275-ACGLN
SELT cDNA ORF Clone, Rat, C-OFPSpark® tag RG81275-ACR
SELT cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81275-CF
SELT cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81275-NF
SELT cDNA ORF Clone, Rat, C-His tag RG81275-CH
SELT cDNA ORF Clone, Rat, N-His tag RG81275-NH
SELT cDNA ORF Clone, Rat, C-HA tag RG81275-CY
SELT cDNA ORF Clone, Rat, N-HA tag RG81275-NY
SELT cDNA ORF Clone, Rat, C-Myc tag RG81275-CM
SELT cDNA ORF Clone, Rat, N-Myc tag RG81275-NM
SELT qPCR Primer Pairs, Rat RP301231

SELT cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SELT cDNA ORF Clone in Cloning Vector, Mouse MG5A2765-U
SELT cDNA ORF Clone, Mouse, untagged MG5A2765-UT
SELT cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A2765-ACG
SELT Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A2765-ACGLN
SELT cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A2765-ACR
SELT cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A2765-CF
SELT cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A2765-NF
SELT cDNA ORF Clone, Mouse, C-His tag MG5A2765-CH
SELT cDNA ORF Clone, Mouse, N-His tag MG5A2765-NH
SELT cDNA ORF Clone, Mouse, C-HA tag MG5A2765-CY
SELT cDNA ORF Clone, Mouse, N-HA tag MG5A2765-NY
SELT cDNA ORF Clone, Mouse, C-Myc tag MG5A2765-CM
SELT cDNA ORF Clone, Mouse, N-Myc tag MG5A2765-NM

SELT cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SELT cDNA ORF Clone in Cloning Vector, Human HG17099-U
SELT cDNA ORF Clone, Human, untagged HG17099-UT
SELT Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17099-ACGLN
SELT cDNA ORF Clone, Human, C-GFPSpark® tag HG17099-ACG
SELT cDNA ORF Clone, Human, C-OFPSpark® tag HG17099-ACR
SELT cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17099-CF
SELT cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17099-NF
SELT cDNA ORF Clone, Human, C-His tag HG17099-CH
SELT cDNA ORF Clone, Human, N-His tag HG17099-NH
SELT cDNA ORF Clone, Human, C-HA tag HG17099-CY
SELT cDNA ORF Clone, Human, N-HA tag HG17099-NY
SELT cDNA ORF Clone, Human, C-Myc tag HG17099-CM
SELT cDNA ORF Clone, Human, N-Myc tag HG17099-NM
info info
添加购物车成功! 添加购物车失败!