PRMT1 cDNA ORF Clone, Canine, untagged

Cat: DG70178-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PRMT1 Reagents
CRO Services
Product recommended

All PRMT1 Reagents
PRMT1 cDNA ORF Clone, Canine, untagged General Information
Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
1029 bp
Description
Full length Clone DNA of Canine protein arginine methyltransferase 1.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PRMT1 Background Information
Full Name
protein arginine methyltransferase 1

PRMT1 cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
PRMT1 cDNA ORF Clone in Cloning Vector, Canine DG70178-U
PRMT1 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70178-ACGLN
PRMT1 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70178-ACG
PRMT1 cDNA ORF Clone, Canine, N-GFPSpark® tag DG70178-ANG
PRMT1 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70178-ACR
PRMT1 cDNA ORF Clone, Canine, N-OFPSpark® tag DG70178-ANR
PRMT1 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70178-CF
PRMT1 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70178-NF
PRMT1 cDNA ORF Clone, Canine, C-His tag DG70178-CH
PRMT1 cDNA ORF Clone, Canine, N-His tag DG70178-NH
PRMT1 cDNA ORF Clone, Canine, C-HA tag DG70178-CY
PRMT1 cDNA ORF Clone, Canine, N-HA tag DG70178-NY
PRMT1 cDNA ORF Clone, Canine, C-Myc tag DG70178-CM
PRMT1 cDNA ORF Clone, Canine, N-Myc tag DG70178-NM

PRMT1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PRMT1 cDNA ORF Clone in Cloning Vector, Mouse MG53838-U
PRMT1 cDNA ORF Clone, Mouse, untagged MG53838-UT
PRMT1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53838-ACG
PRMT1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53838-ACGLN
PRMT1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53838-ANG
PRMT1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53838-ACR
PRMT1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53838-ANR
PRMT1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53838-CF
PRMT1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53838-NF
PRMT1 cDNA ORF Clone, Mouse, C-His tag MG53838-CH
PRMT1 cDNA ORF Clone, Mouse, N-His tag MG53838-NH
PRMT1 cDNA ORF Clone, Mouse, C-HA tag MG53838-CY
PRMT1 cDNA ORF Clone, Mouse, N-HA tag MG53838-NY
PRMT1 cDNA ORF Clone, Mouse, C-Myc tag MG53838-CM
PRMT1 cDNA ORF Clone, Mouse, N-Myc tag MG53838-NM

PRMT1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PRMT1 cDNA ORF Clone in Cloning Vector, Human HG11210-M
PRMT1 cDNA ORF Clone, Human, untagged HG11210-UT
PRMT1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11210-ACGLN
PRMT1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11210-ACG
PRMT1 cDNA ORF Clone, Human, N-GFPSpark® tag HG11210-ANG
PRMT1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11210-ACR
PRMT1 cDNA ORF Clone, Human, N-OFPSpark® tag HG11210-ANR
PRMT1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11210-CF
PRMT1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11210-NF
PRMT1 cDNA ORF Clone, Human, C-His tag HG11210-CH
PRMT1 cDNA ORF Clone, Human, N-His tag HG11210-NH
PRMT1 cDNA ORF Clone, Human, C-HA tag HG11210-CY
PRMT1 cDNA ORF Clone, Human, N-HA tag HG11210-NY
PRMT1 cDNA ORF Clone, Human, C-Myc tag HG11210-CM
PRMT1 cDNA ORF Clone, Human, N-Myc tag HG11210-NM
PRMT1 qPCR Primer Pairs, Human HP101114
info info
添加购物车成功! 添加购物车失败!