PPP2CB cDNA ORF Clone, Canine, untagged

Cat: DG70234-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PPP2CB Reagents
CRO Services
Product recommended

All PPP2CB Reagents
PPP2CB cDNA ORF Clone, Canine, untagged General Information
Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
930 bp
Description
Full length Clone DNA of Canine protein phosphatase 2, catalytic subunit, beta isozyme.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PPP2CB Background Information
Full Name
protein phosphatase 2, catalytic subunit, beta isozyme

PPP2CB cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
PPP2CB cDNA ORF Clone in Cloning Vector, Cynomolgus CG90451-G
PPP2CB cDNA ORF Clone, Cynomolgus, untagged CG90451-UT
PPP2CB cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90451-ACG
PPP2CB Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90451-ACGLN
PPP2CB cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90451-ANG
PPP2CB cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90451-ACR
PPP2CB cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90451-ANR
PPP2CB cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90451-CF
PPP2CB cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90451-NF
PPP2CB cDNA ORF Clone, Cynomolgus, C-His tag CG90451-CH
PPP2CB cDNA ORF Clone, Cynomolgus, N-His tag CG90451-NH
PPP2CB cDNA ORF Clone, Cynomolgus, C-HA tag CG90451-CY
PPP2CB cDNA ORF Clone, Cynomolgus, N-HA tag CG90451-NY
PPP2CB cDNA ORF Clone, Cynomolgus, C-Myc tag CG90451-CM
PPP2CB cDNA ORF Clone, Cynomolgus, N-Myc tag CG90451-NM

PPP2CB cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
PPP2CB cDNA ORF Clone in Cloning Vector, Canine DG70234-U
PPP2CB cDNA ORF Clone, Canine, C-GFPSpark® tag DG70234-ACG
PPP2CB Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70234-ACGLN
PPP2CB cDNA ORF Clone, Canine, N-GFPSpark® tag DG70234-ANG
PPP2CB cDNA ORF Clone, Canine, C-OFPSpark® tag DG70234-ACR
PPP2CB cDNA ORF Clone, Canine, N-OFPSpark® tag DG70234-ANR
PPP2CB cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70234-CF
PPP2CB cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70234-NF
PPP2CB cDNA ORF Clone, Canine, C-His tag DG70234-CH
PPP2CB cDNA ORF Clone, Canine, N-His tag DG70234-NH
PPP2CB cDNA ORF Clone, Canine, C-HA tag DG70234-CY
PPP2CB cDNA ORF Clone, Canine, N-HA tag DG70234-NY
PPP2CB cDNA ORF Clone, Canine, C-Myc tag DG70234-CM
PPP2CB cDNA ORF Clone, Canine, N-Myc tag DG70234-NM

PPP2CB cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PPP2CB cDNA ORF Clone in Cloning Vector, Mouse MG51617-G
PPP2CB cDNA ORF Clone, Mouse, untagged MG51617-UT
PPP2CB Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51617-ACGLN
PPP2CB cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51617-ACG
PPP2CB cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51617-ANG
PPP2CB cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51617-ACR
PPP2CB cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51617-ANR
PPP2CB cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51617-CF
PPP2CB cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51617-NF
PPP2CB cDNA ORF Clone, Mouse, C-His tag MG51617-CH
PPP2CB cDNA ORF Clone, Mouse, N-His tag MG51617-NH
PPP2CB cDNA ORF Clone, Mouse, C-HA tag MG51617-CY
PPP2CB cDNA ORF Clone, Mouse, N-HA tag MG51617-NY
PPP2CB cDNA ORF Clone, Mouse, C-Myc tag MG51617-CM
PPP2CB cDNA ORF Clone, Mouse, N-Myc tag MG51617-NM
PPP2CB qPCR Primer Pairs, Mouse MP201490
info info
添加购物车成功! 添加购物车失败!