PHF5A cDNA ORF Clone, Canine, C-DDK (Flag®) tag

Cat: DG70205-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PHF5A Reagents
CRO Services
Product recommended

All PHF5A Reagents
PHF5A cDNA ORF Clone, Canine, C-DDK (Flag®) tag General Information
Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
333 bp
Description
Full length Clone DNA of Canine PHD finger protein 5A with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PHF5A Background Information
Full Name
PHD finger protein 5A

PHF5A cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
PHF5A cDNA ORF Clone in Cloning Vector, Canine DG70205-U
PHF5A cDNA ORF Clone, Canine, untagged DG70205-UT
PHF5A Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70205-ACGLN
PHF5A cDNA ORF Clone, Canine, C-GFPSpark® tag DG70205-ACG
PHF5A cDNA ORF Clone, Canine, N-GFPSpark® tag DG70205-ANG
PHF5A cDNA ORF Clone, Canine, C-OFPSpark® tag DG70205-ACR
PHF5A cDNA ORF Clone, Canine, N-OFPSpark® tag DG70205-ANR
PHF5A cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70205-NF
PHF5A cDNA ORF Clone, Canine, C-His tag DG70205-CH
PHF5A cDNA ORF Clone, Canine, N-His tag DG70205-NH
PHF5A cDNA ORF Clone, Canine, C-HA tag DG70205-CY
PHF5A cDNA ORF Clone, Canine, N-HA tag DG70205-NY
PHF5A cDNA ORF Clone, Canine, C-Myc tag DG70205-CM
PHF5A cDNA ORF Clone, Canine, N-Myc tag DG70205-NM

PHF5A cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PHF5A cDNA ORF Clone in Cloning Vector, Rat RG81088-U
PHF5A cDNA ORF Clone, Rat, untagged RG81088-UT
PHF5A Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81088-ACGLN
PHF5A cDNA ORF Clone, Rat, C-GFPSpark® tag RG81088-ACG
PHF5A cDNA ORF Clone, Rat, N-GFPSpark® tag RG81088-ANG
PHF5A cDNA ORF Clone, Rat, C-OFPSpark® tag RG81088-ACR
PHF5A cDNA ORF Clone, Rat, N-OFPSpark® tag RG81088-ANR
PHF5A cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81088-CF
PHF5A cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81088-NF
PHF5A cDNA ORF Clone, Rat, C-His tag RG81088-CH
PHF5A cDNA ORF Clone, Rat, N-His tag RG81088-NH
PHF5A cDNA ORF Clone, Rat, C-HA tag RG81088-CY
PHF5A cDNA ORF Clone, Rat, N-HA tag RG81088-NY
PHF5A cDNA ORF Clone, Rat, C-Myc tag RG81088-CM
PHF5A cDNA ORF Clone, Rat, N-Myc tag RG81088-NM
PHF5A qPCR Primer Pairs, Rat RP301045

PHF5A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PHF5A cDNA ORF Clone in Cloning Vector, Human HG16814-U
PHF5A cDNA ORF Clone, Human, untagged HG16814-UT
PHF5A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16814-ACGLN
PHF5A cDNA ORF Clone, Human, C-GFPSpark® tag HG16814-ACG
PHF5A cDNA ORF Clone, Human, N-GFPSpark® tag HG16814-ANG
PHF5A cDNA ORF Clone, Human, C-OFPSpark® tag HG16814-ACR
PHF5A cDNA ORF Clone, Human, N-OFPSpark® tag HG16814-ANR
PHF5A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16814-CF
PHF5A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16814-NF
PHF5A cDNA ORF Clone, Human, C-His tag HG16814-CH
PHF5A cDNA ORF Clone, Human, N-His tag HG16814-NH
PHF5A cDNA ORF Clone, Human, C-HA tag HG16814-CY
PHF5A cDNA ORF Clone, Human, N-HA tag HG16814-NY
PHF5A cDNA ORF Clone, Human, C-Myc tag HG16814-CM
PHF5A cDNA ORF Clone, Human, N-Myc tag HG16814-NM
info info
添加购物车成功! 添加购物车失败!