NOV / CCN3 cDNA ORF Clone, Canine, untagged

Cat: DG70043-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All NOV / CCN3 Reagents
CRO Services
Product recommended

All NOV / CCN3 Reagents
NOV / CCN3 cDNA ORF Clone, Canine, untagged General Information
Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
1062 bp
Description
Full length Clone DNA of Canine nephroblastoma overexpressed gene.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NOV / CCN3 Background Information

Protein NOV homolog, also known as Nephroblastoma-overexpressed gene protein homolog, NOV, and CCN3, is a putative ligand for integrin receptors, is tightly associated with the extracellular matrix and mediates diverse cellular functions, including cell adhesion and proliferation. CCN3 has been shown to negatively regulate growth although it promotes migration in a cell type-specific manner. This secreted protein belongs to the CCN family, and its expression was observed in a broad variety of tissues from the early stage of development , and altered expression of CCN3 has been observed in a variety of tumors, including hepatocellular carcinomas, Wilm's tumors, Ewing's sarcomas, gliomas, rhabdomyosarcomas, and adrenocortical carcinomas. Mature CCN3 protein has five distinct modules and truncated protein variants with altered function are found in many cancers. CCN3 acts through the core stem cell signalling pathways including Notch and Bone Morphogenic Protein, connecting CCN3 with the modulation of self-renewal and maturation of a number of cell lineages including hematopoietic, osteogenic and chondrogenic. CCN3 may affect the extracellular environment of the niche for hematopoietic stem cells. CCN3 has emerged as a key player in stem cell regulation, hematopoiesis and a crucial component within the bone marrow microenvironment.

Full Name
nephroblastoma overexpressed
References
  • Manara MC, et al. (2002) The expression of ccn3(nov) gene in musculoskeletal tumors. Am J Pathol. 160(3): 849-59.
  • Lin CG, et al. (2003) CCN3 (NOV) is a novel angiogenic regulator of the CCN protein family. J Biol Chem. 278(26): 24200-8.
  • Vallacchi V, et al. (2009) CCN3/nephroblastoma overexpressed matricellular protein regulates integrin expression, adhesion, and dissemination in melanoma. Cancer Res. 68(3): 715-23.
  • Sin WC, et al. (2009) Matricellular protein CCN3 (NOV) regulates actin cytoskeleton reorganization. J Biol Chem. 284(43): 29935-44.
  • McCallum L, et al. (2009) CCN3--a key regulator of the hematopoietic compartment. Blood Rev. 23(2): 79-85.
  • NOV / CCN3 cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    NOV / CCN3 cDNA ORF Clone in Cloning Vector, Canine DG70043-G
    NOV / CCN3 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70043-ACGLN
    NOV / CCN3 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70043-ACG
    NOV / CCN3 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70043-ACR
    NOV / CCN3 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70043-CF
    NOV / CCN3 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70043-NF
    NOV / CCN3 cDNA ORF Clone, Canine, C-His tag DG70043-CH
    NOV / CCN3 cDNA ORF Clone, Canine, N-His tag DG70043-NH
    NOV / CCN3 cDNA ORF Clone, Canine, C-HA tag DG70043-CY
    NOV / CCN3 cDNA ORF Clone, Canine, N-HA tag DG70043-NY
    NOV / CCN3 cDNA ORF Clone, Canine, C-Myc tag DG70043-CM
    NOV / CCN3 cDNA ORF Clone, Canine, N-Myc tag DG70043-NM

    NOV / CCN3 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    NOV / CCN3 cDNA ORF Clone in Cloning Vector, Rhesus CG90081-G
    NOV / CCN3 cDNA ORF Clone, Rhesus, untagged CG90081-UT
    NOV / CCN3 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90081-ACGLN
    NOV / CCN3 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90081-ACG
    NOV / CCN3 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90081-ACR
    NOV / CCN3 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90081-CF
    NOV / CCN3 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90081-NF
    NOV / CCN3 cDNA ORF Clone, Rhesus, C-His tag CG90081-CH
    NOV / CCN3 cDNA ORF Clone, Rhesus, N-His tag CG90081-NH
    NOV / CCN3 cDNA ORF Clone, Rhesus, C-HA tag CG90081-CY
    NOV / CCN3 cDNA ORF Clone, Rhesus, N-HA tag CG90081-NY
    NOV / CCN3 cDNA ORF Clone, Rhesus, C-Myc tag CG90081-CM
    NOV / CCN3 cDNA ORF Clone, Rhesus, N-Myc tag CG90081-NM

    NOV / CCN3 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    NOV / CCN3 cDNA ORF Clone in Cloning Vector, Mouse MG50455-M
    NOV / CCN3 cDNA ORF Clone, Mouse, untagged MG50455-UT
    NOV / CCN3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50455-ACGLN
    NOV / CCN3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50455-ACG
    NOV / CCN3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50455-ACR
    NOV / CCN3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50455-CF
    NOV / CCN3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50455-NF
    NOV / CCN3 cDNA ORF Clone, Mouse, C-His tag MG50455-CH
    NOV / CCN3 cDNA ORF Clone, Mouse, N-His tag MG50455-NH
    NOV / CCN3 cDNA ORF Clone, Mouse, C-HA tag MG50455-CY
    NOV / CCN3 cDNA ORF Clone, Mouse, N-HA tag MG50455-NY
    NOV / CCN3 cDNA ORF Clone, Mouse, C-Myc tag MG50455-CM
    NOV / CCN3 cDNA ORF Clone, Mouse, N-Myc tag MG50455-NM
    NOV / CCN3 qPCR Primer Pairs, Mouse MP200460

    NOV / CCN3 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    NOV / CCN3 cDNA ORF Clone in Cloning Vector, Human HG10264-M
    NOV / CCN3 cDNA ORF Clone, Human, untagged HG10264-UT
    NOV / CCN3 cDNA ORF Clone, Human, C-GFPSpark® tag HG10264-ACG
    NOV / CCN3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10264-ACGLN
    NOV / CCN3 cDNA ORF Clone, Human, C-OFPSpark® tag HG10264-ACR
    NOV / CCN3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10264-CF
    NOV / CCN3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10264-NF
    NOV / CCN3 cDNA ORF Clone, Human, C-His tag HG10264-CH
    NOV / CCN3 cDNA ORF Clone, Human, N-His tag HG10264-NH
    NOV / CCN3 cDNA ORF Clone, Human, C-HA tag HG10264-CY
    NOV / CCN3 cDNA ORF Clone, Human, N-HA tag HG10264-NY
    NOV / CCN3 cDNA ORF Clone, Human, C-Myc tag HG10264-CM
    NOV / CCN3 cDNA ORF Clone, Human, N-Myc tag HG10264-NM
    NOV / CCN3 qPCR Primer Pairs, Human HP100312
    info info
    添加购物车成功! 添加购物车失败!