MFAP3L cDNA ORF Clone, Canine, untagged

Cat: DG70235-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All MFAP3L Reagents
CRO Services
Product recommended

All MFAP3L Reagents
MFAP3L cDNA ORF Clone, Canine, untagged General Information
Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
1227 bp
Description
Full length Clone DNA of Canine microfibrillar-associated protein 3-like.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MFAP3L Background Information
Full Name
microfibrillar-associated protein 3-like

MFAP3L cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
MFAP3L cDNA ORF Clone in Cloning Vector, Canine DG70235-U
MFAP3L Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70235-ACGLN
MFAP3L cDNA ORF Clone, Canine, C-GFPSpark® tag DG70235-ACG
MFAP3L cDNA ORF Clone, Canine, C-OFPSpark® tag DG70235-ACR
MFAP3L cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70235-CF
MFAP3L cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70235-NF
MFAP3L cDNA ORF Clone, Canine, C-His tag DG70235-CH
MFAP3L cDNA ORF Clone, Canine, N-His tag DG70235-NH
MFAP3L cDNA ORF Clone, Canine, C-HA tag DG70235-CY
MFAP3L cDNA ORF Clone, Canine, N-HA tag DG70235-NY
MFAP3L cDNA ORF Clone, Canine, C-Myc tag DG70235-CM
MFAP3L cDNA ORF Clone, Canine, N-Myc tag DG70235-NM

MFAP3L cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MFAP3L cDNA ORF Clone in Cloning Vector, Human HG13630-G
MFAP3L cDNA ORF Clone, Human, untagged HG13630-UT
MFAP3L cDNA ORF Clone, Human, C-GFPSpark® tag HG13630-ACG
MFAP3L Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13630-ACGLN
MFAP3L cDNA ORF Clone, Human, C-OFPSpark® tag HG13630-ACR
MFAP3L cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13630-CF
MFAP3L cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13630-NF
MFAP3L cDNA ORF Clone, Human, C-His tag HG13630-CH
MFAP3L cDNA ORF Clone, Human, N-His tag HG13630-NH
MFAP3L cDNA ORF Clone, Human, C-HA tag HG13630-CY
MFAP3L cDNA ORF Clone, Human, N-HA tag HG13630-NY
MFAP3L cDNA ORF Clone, Human, C-Myc tag HG13630-CM
MFAP3L cDNA ORF Clone, Human, N-Myc tag HG13630-NM
MFAP3L qPCR Primer Pairs, Human HP102314
info info
添加购物车成功! 添加购物车失败!