Quick Order

Text Size:AAA

Canine vesicle-trafficking protein SEC22b-like Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Canine LOC475816 cDNA Clone Product Information
NCBI RefSeq:XM_533025.4
RefSeq ORF Size:648bp
cDNA Description:Full length Clone DNA of Canis lupus familiaris vesicle-trafficking protein SEC22b-like.
Gene Synonym:SEC22B
Species:Canine
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Canine vesicle-trafficking protein SEC22b-like Gene ORF cDNA clone expression plasmid on other vectors
Canine vesicle-trafficking protein SEC22b-like Gene ORF cDNA clone expression plasmid, C-GFPSpark tagDG70227-ACG$225
Canine vesicle-trafficking protein SEC22b-like Gene ORF cDNA clone expression plasmid, C-OFPSpark tagDG70227-ACR$225
Canine vesicle-trafficking protein SEC22b-like Gene ORF cDNA clone expression plasmid, N-GFPSpark tagDG70227-ANG$225
Canine vesicle-trafficking protein SEC22b-like Gene ORF cDNA clone expression plasmid, N-OFPSpark tagDG70227-ANR$225
Canine vesicle-trafficking protein SEC22b-like Gene ORF cDNA clone expression plasmid, C-Flag tagDG70227-CF$195
Canine vesicle-trafficking protein SEC22b-like Gene ORF cDNA clone expression plasmid, C-His tagDG70227-CH$195
Canine vesicle-trafficking protein SEC22b-like Gene ORF cDNA clone expression plasmid, C-Myc tagDG70227-CM$195
Canine vesicle-trafficking protein SEC22b-like Gene ORF cDNA clone expression plasmid, C-HA tagDG70227-CY$195
Canine vesicle-trafficking protein SEC22b-like Gene ORF cDNA clone expression plasmid, N-Flag tagDG70227-NF$195
Canine vesicle-trafficking protein SEC22b-like Gene ORF cDNA clone expression plasmid, N-His tagDG70227-NH$195
Canine vesicle-trafficking protein SEC22b-like Gene ORF cDNA clone expression plasmid, N-Myc tagDG70227-NM$195
Canine vesicle-trafficking protein SEC22b-like Gene ORF cDNA clone expression plasmid, N-HA tagDG70227-NY$195
Canine vesicle-trafficking protein SEC22b-like Gene ORF cDNA clone in cloning vectorDG70227-U$75
Canine vesicle-trafficking protein SEC22b-like Gene ORF cDNA clone expression plasmidDG70227-UT$195
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: DG70227-UT
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability2-3 weeks
Bulk Discount InquiryAdd to Cart
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"