Quick Order

Text Size:AAA

Canine vesicle-trafficking protein SEC22b-like Gene ORF cDNA clone expression plasmid, C-Flag tag

DatasheetReviewsRelated ProductsProtocols
Canine LOC475816 cDNA Clone Product Information
NCBI RefSeq:XM_533025.4
RefSeq ORF Size:648bp
cDNA Description:Full length Clone DNA of Canis lupus familiaris vesicle-trafficking protein SEC22b-like with C terminal Flag tag.
Gene Synonym:SEC22B
Species:Canine
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Canine vesicle-trafficking protein SEC22b-like Gene ORF cDNA clone expression plasmid, C-Flag tag on other vectors
Canine vesicle-trafficking protein SEC22b-like Gene ORF cDNA clone expression plasmid, C-GFPSpark tagDG70227-ACG$225
Canine vesicle-trafficking protein SEC22b-like Gene ORF cDNA clone expression plasmid, C-OFPSpark tagDG70227-ACR$225
Canine vesicle-trafficking protein SEC22b-like Gene ORF cDNA clone expression plasmid, N-GFPSpark tagDG70227-ANG$225
Canine vesicle-trafficking protein SEC22b-like Gene ORF cDNA clone expression plasmid, N-OFPSpark tagDG70227-ANR$225
Canine vesicle-trafficking protein SEC22b-like Gene ORF cDNA clone expression plasmid, C-Flag tagDG70227-CF$195
Canine vesicle-trafficking protein SEC22b-like Gene ORF cDNA clone expression plasmid, C-His tagDG70227-CH$195
Canine vesicle-trafficking protein SEC22b-like Gene ORF cDNA clone expression plasmid, C-Myc tagDG70227-CM$195
Canine vesicle-trafficking protein SEC22b-like Gene ORF cDNA clone expression plasmid, C-HA tagDG70227-CY$195
Canine vesicle-trafficking protein SEC22b-like Gene ORF cDNA clone expression plasmid, N-Flag tagDG70227-NF$195
Canine vesicle-trafficking protein SEC22b-like Gene ORF cDNA clone expression plasmid, N-His tagDG70227-NH$195
Canine vesicle-trafficking protein SEC22b-like Gene ORF cDNA clone expression plasmid, N-Myc tagDG70227-NM$195
Canine vesicle-trafficking protein SEC22b-like Gene ORF cDNA clone expression plasmid, N-HA tagDG70227-NY$195
Canine vesicle-trafficking protein SEC22b-like Gene ORF cDNA clone in cloning vectorDG70227-U$75
Canine vesicle-trafficking protein SEC22b-like Gene ORF cDNA clone expression plasmidDG70227-UT$195
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: DG70227-CF
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability2-3 weeks
Bulk Discount InquiryAdd to Cart
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"