Text Size:AAA

Canine IL4/IL-4/Interleukin-4 Gene ORF cDNA clone expression plasmid

    DatasheetReviewsRelated ProductsProtocols
    Canine IL4 cDNA Clone Product Information
    NCBI RefSeq:NM_001003159.1
    RefSeq ORF Size:399bp
    cDNA Description:Full length Clone DNA of Canine interleukin 4.
    Gene Synonym:IL-4, IL4
    Restriction Site:
    Tag Sequence:
    Sequence Description:
    Sequencing primers:T7( 5' TAATACGACTCACTATAGGG 3' )
    Promoter:Enhanced CMV cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Product nameProduct name

    Interleukin-4, also known as IL4, is a secreted protein which belongs to the IL-4 / IL-13 family. Interleukin-4 / IL4 has many biological roles, including the stimulation of activated B-cell and T-cell proliferation. It enhances both secretion and cell surface expression of IgE and IgG1. Interleukin-4 / IL4 also regulates the expression of the low affinity Fc receptor for IgE (CD23) on both lymphocytes and monocytes. Interleukin-4 is essential for the switching of B cells to IgE antibody production and for the maturation of T helper (Th) cells toward the Th2 phenotype. It participates in at least several B-cell activation processes as well as of other cell types. However, studies show that double mutant (Q116D, Y119D) of the murine IL4 protein (QY), both glutamine 116 and tyrosine 119, which binds to the IL4 receptor alpha, completely inhibites in a dose-dependent manner the IL4-induced proliferation of lipopolysaccharide-stimulated murine splenic B-cells, of the murine T cell line CTLL-2, and of the murine pre-B-cell line BA/F3. QY also inhibited the IL4-stimulated up-regulation of CD23 expression by lipopolysaccharide-stimulated murine splenic B-cells and abolished tyrosine phosphorylation of the transcription factor Stat6 and the tyrosine kinase Jak3 in IL4-stimulated BA/F3 cells.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

  • Grunewald SM. et al., 1998, J Immunol. 160 (8): 4004-9.
  • Susanne M. et al, 1997, THE JOURNAL OF BIOLOGICAL CHEMISTRY. 272 (3): 1480-3.
  • Nishikubo K. et al., 2003, Gene Ther. 10 (26): 2119-25.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.