IL-34 cDNA ORF Clone, Canine, untagged

Cat: DG70091-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All IL-34 Reagents
CRO Services
Product recommended

All IL-34 Reagents
IL-34 cDNA ORF Clone, Canine, untagged General Information
Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
711 bp
Description
Full length Clone DNA of Canine interleukin 34.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL-34 Background Information

Interleukin 34 (IL-34), also known as uncharacterized protein C16 or f77 homolog, is a secreted cytokine that belongs to unknown cytokine family. IL-34 protein is expressed in various tissues, including heart, brain, lung, liver, kidney, spleen, thymus, testes, ovary, small intestine, prostate and colon, and most abundant in the spleen. The colony-stimulating factor 1 receptor (CSF-1R) is identified as the receptor for IL-34. IL-34 increases growth or survival of immune cells known as monocytes. In addition, IL-34 promoted the formation of the colony-forming unit-macrophage (CFU-M), a macrophage progenitor, in human bone marrow cultures.

Full Name
interleukin 34
References
  • Lin H, et al. (2008) Discovery of a cytokine and its receptor by functional screening of the extracellular proteome. Science. 320(5877): 807-11.
  • IL-34 cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    IL-34 cDNA ORF Clone in Cloning Vector, Canine DG70091-G
    IL-34 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70091-ACGLN
    IL-34 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70091-ACG
    IL-34 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70091-ACR
    IL-34 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70091-CF
    IL-34 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70091-NF
    IL-34 cDNA ORF Clone, Canine, C-His tag DG70091-CH
    IL-34 cDNA ORF Clone, Canine, N-His tag DG70091-NH
    IL-34 cDNA ORF Clone, Canine, C-HA tag DG70091-CY
    IL-34 cDNA ORF Clone, Canine, N-HA tag DG70091-NY
    IL-34 cDNA ORF Clone, Canine, C-Myc tag DG70091-CM
    IL-34 cDNA ORF Clone, Canine, N-Myc tag DG70091-NM

    IL-34 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    IL-34 cDNA ORF Clone in Cloning Vector, Mouse MG50055-M
    IL-34 cDNA ORF Clone, Mouse, untagged MG50055-UT
    IL-34 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50055-ACG
    IL-34 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50055-ACGLN
    IL-34 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50055-ACR
    IL-34 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50055-CF
    IL-34 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50055-NF
    IL-34 cDNA ORF Clone, Mouse, C-His tag MG50055-CH
    IL-34 cDNA ORF Clone, Mouse, N-His tag MG50055-NH
    IL-34 cDNA ORF Clone, Mouse, C-HA tag MG50055-CY
    IL-34 cDNA ORF Clone, Mouse, N-HA tag MG50055-NY
    IL-34 cDNA ORF Clone, Mouse, C-Myc tag MG50055-CM
    IL-34 cDNA ORF Clone, Mouse, N-Myc tag MG50055-NM
    IL-34 qPCR Primer Pairs, Mouse MP200055

    IL-34 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IL-34 cDNA ORF Clone in Cloning Vector, Human HG10948-M
    IL-34 cDNA ORF Clone, Human, untagged HG10948-UT
    IL-34 cDNA ORF Clone, Human, C-GFPSpark® tag HG10948-ACG
    IL-34 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10948-ACGLN
    IL-34 cDNA ORF Clone, Human, C-OFPSpark® tag HG10948-ACR
    IL-34 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10948-CF
    IL-34 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10948-NF
    IL-34 cDNA ORF Clone, Human, C-His tag HG10948-CH
    IL-34 cDNA ORF Clone, Human, N-His tag HG10948-NH
    IL-34 cDNA ORF Clone, Human, C-HA tag HG10948-CY
    IL-34 cDNA ORF Clone, Human, N-HA tag HG10948-NY
    IL-34 cDNA ORF Clone, Human, C-Myc tag HG10948-CM
    IL-34 cDNA ORF Clone, Human, N-Myc tag HG10948-NM
    IL-34 qPCR Primer Pairs, Human HP100825

    IL-34 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    IL-34 qPCR Primer Pairs, Rat RP300187
    info info
    添加购物车成功! 添加购物车失败!