After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Canine IL-34 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Canine IL34 cDNA Clone Product Information
NCBI RefSeq:XM_848059.2
RefSeq ORF Size:711bp
cDNA Description:Full length Clone DNA of Canis lupus familiaris interleukin 34.
Gene Synonym:IL34
Species:Canine
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Interleukin 34 (IL-34), also known as uncharacterized protein C16 or f77 homolog, is a secreted cytokine that belongs to unknown cytokine family. IL-34 protein is expressed in various tissues, including heart, brain, lung, liver, kidney, spleen, thymus, testes, ovary, small intestine, prostate and colon, and most abundant in the spleen. The colony-stimulating factor 1 receptor (CSF-1R) is identified as the receptor for IL-34. IL-34 increases growth or survival of immune cells known as monocytes. In addition, IL-34 promoted the formation of the colony-forming unit-macrophage (CFU-M), a macrophage progenitor, in human bone marrow cultures.

References
  • Lin H, et al. (2008) Discovery of a cytokine and its receptor by functional screening of the extracellular proteome. Science. 320(5877): 807-11.
  • Size / Price
    Catalog: DG70091-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"