Quick Order

Canine IL33 natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Canine IL33 cDNA Clone Product Information
NCBI RefSeq:NM_001003180.1
RefSeq ORF Size:801bp
cDNA Description:Full length Clone DNA of Canis lupus familiaris interleukin 33.
Gene Synonym:IL33
Species:Canine
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Interleukin 33 (IL-33), also known as DVS27 or NF-HEV (Nuclear Factor from High Endothelial enules), is a proinflammatory protein and a chromatin-associated cytokine of the IL-1 family with high sequence and structural similarity to IL-1 and IL-18. IL-33 protein is expressed highly and rather selectively by high endothelial venule endothelial cells (HEVECs) in human tonsils, Peyers's patches, and lymph nodes. IL-33 protein has transcriptional regulatory properties, and the researches suggested that IL-33 is a dual-function protein that might act both as a cytokine and as an intracellular nuclear factor. As a type 2 cytokines, IL-33 protein also play a pivotal role in helminthic infection and allergic disorders.

References
  • Iikura M, et al. (2007) IL-33 can promote survival, adhesion and cytokine production in human mast cells. Lab Invest. 87(10): 971-8.
  • Lamkanfi M, et al. (2009) IL-33 raises alarm. Immunity. 31(1): 5-7.
  • Size / Price
    Catalog: DG70005-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability
     Shipping instructions
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"