Quick Order

Canine IL33 ORF mammalian expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Canine IL33 cDNA Clone Product Information
NCBI RefSeq:NM_001003180.1
RefSeq ORF Size:801bp
cDNA Description:Full length Clone DNA of Canis lupus familiaris interleukin 33 with N terminal Myc tag.
Gene Synonym:IL33
Species:Canine
Vector:pCMV3-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Interleukin 33 (IL-33), also known as DVS27 or NF-HEV (Nuclear Factor from High Endothelial enules), is a proinflammatory protein and a chromatin-associated cytokine of the IL-1 family with high sequence and structural similarity to IL-1 and IL-18. IL-33 protein is expressed highly and rather selectively by high endothelial venule endothelial cells (HEVECs) in human tonsils, Peyers's patches, and lymph nodes. IL-33 protein has transcriptional regulatory properties, and the researches suggested that IL-33 is a dual-function protein that might act both as a cytokine and as an intracellular nuclear factor. As a type 2 cytokines, IL-33 protein also play a pivotal role in helminthic infection and allergic disorders.

References
  • Iikura M, et al. (2007) IL-33 can promote survival, adhesion and cytokine production in human mast cells. Lab Invest. 87(10): 971-8.
  • Lamkanfi M, et al. (2009) IL-33 raises alarm. Immunity. 31(1): 5-7.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"