IL18R1 cDNA ORF Clone, Canine, untagged

Cat: DG70081-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All IL18R1 Reagents
CRO Services
Product recommended

All IL18R1 Reagents
IL18R1 cDNA ORF Clone, Canine, untagged General Information
Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
1617 bp
Description
Full length Clone DNA of Canine interleukin 18 receptor 1.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL18R1 Background Information

Interleukin-18 receptor 1 (IL18R1) also known as CD218 antigen-like family member A, CDw218a, IL1 receptor-related protein and CD218a, is an interleukin receptor of the immunoglobulin superfamily. IL18R1 is found expressed in lung, leukocytes, spleen, liver, thymus, prostate, small intestine, colon, placenta, and heart, and is absent from brain, skeletal muscle, pancreas, and kidney. High level of expression is found in Hodgkin disease cell lines. This receptor is specifically binds interleukin 18 (IL18), and is essential for IL18 mediated signal transduction. IL18R1 contains 3 Ig-like C2-type (immunoglobulin-like) domains and 1 TIR domain. It is a single-pass type I membrane protein. IFN-alpha and IL12 are reported to induce the expression of this receptor in NK and T cells. The increased expression of IL18R1 may contribute pathogenically to disease and is therefore a potential therapeutic target. The absence of a genetic association in the IL18R1 gene itself suggests regulation from other parts of the genome, or as part of the inflammatory cascade in multiple sclerosis without a prime genetic cause.

Full Name
interleukin 18 receptor 1
References
  • Nadif R, et al.. (2006) IL18 and IL18R1 polymorphisms, lung CT and fibrosis: A longitudinal study in coal miners. Eur Respir J. 28(6): 1100-5.
  • Haralambieva IH, et al.. (2011) Common SNPs/haplotypes in IL18R1 and IL18 genes are associated with variations in hum oral immunity to smallpox vaccination in Caucasians and African Americans. J Infect Dis. 204(3): 433-41.
  • Hulin-Curtis SL, et al.. (2012) Evaluation of IL18 and IL18R1 polymorphisms: genetic susceptibility to knee osteoarthritis. Int J Immunogenet. 39(2): 106-9.
  • IL18R1 cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    IL18R1 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70081-ACGLN
    IL18R1 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70081-CF
    IL18R1 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70081-NF
    IL18R1 cDNA ORF Clone, Canine, C-His tag DG70081-CH
    IL18R1 cDNA ORF Clone, Canine, N-His tag DG70081-NH
    IL18R1 cDNA ORF Clone, Canine, C-HA tag DG70081-CY
    IL18R1 cDNA ORF Clone, Canine, N-HA tag DG70081-NY
    IL18R1 cDNA ORF Clone, Canine, C-Myc tag DG70081-CM
    IL18R1 cDNA ORF Clone, Canine, N-Myc tag DG70081-NM

    IL18R1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    IL18R1 cDNA ORF Clone in Cloning Vector, Rat RG80191-G
    IL18R1 cDNA ORF Clone, Rat, untagged RG80191-UT
    IL18R1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80191-ACG
    IL18R1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80191-ACGLN
    IL18R1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80191-ACR
    IL18R1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80191-CF
    IL18R1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80191-NF
    IL18R1 cDNA ORF Clone, Rat, C-His tag RG80191-CH
    IL18R1 cDNA ORF Clone, Rat, N-His tag RG80191-NH
    IL18R1 cDNA ORF Clone, Rat, C-HA tag RG80191-CY
    IL18R1 cDNA ORF Clone, Rat, N-HA tag RG80191-NY
    IL18R1 cDNA ORF Clone, Rat, C-Myc tag RG80191-CM
    IL18R1 cDNA ORF Clone, Rat, N-Myc tag RG80191-NM
    IL18R1 qPCR Primer Pairs, Rat RP300183

    IL18R1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    IL18R1 cDNA ORF Clone in Cloning Vector, Mouse MG50094-M
    IL18R1 cDNA ORF Clone, Mouse, untagged MG50094-UT
    IL18R1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50094-ACG
    IL18R1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50094-ACGLN
    IL18R1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50094-ACR
    IL18R1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50094-CF
    IL18R1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50094-NF
    IL18R1 cDNA ORF Clone, Mouse, C-His tag MG50094-CH
    IL18R1 cDNA ORF Clone, Mouse, N-His tag MG50094-NH
    IL18R1 cDNA ORF Clone, Mouse, C-HA tag MG50094-CY
    IL18R1 cDNA ORF Clone, Mouse, N-HA tag MG50094-NY
    IL18R1 cDNA ORF Clone, Mouse, C-Myc tag MG50094-CM
    IL18R1 cDNA ORF Clone, Mouse, N-Myc tag MG50094-NM
    IL18R1 qPCR Primer Pairs, Mouse MP200124

    IL18R1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IL18R1 cDNA ORF Clone in Cloning Vector, Human HG11102-M
    IL18R1 cDNA ORF Clone, Human, untagged HG11102-UT
    IL18R1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11102-ACG
    IL18R1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11102-ACGLN
    IL18R1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11102-ACR
    IL18R1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11102-CF
    IL18R1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11102-NF
    IL18R1 cDNA ORF Clone, Human, C-His tag HG11102-CH
    IL18R1 cDNA ORF Clone, Human, N-His tag HG11102-NH
    IL18R1 cDNA ORF Clone, Human, C-HA tag HG11102-CY
    IL18R1 cDNA ORF Clone, Human, N-HA tag HG11102-NY
    IL18R1 cDNA ORF Clone, Human, C-Myc tag HG11102-CM
    IL18R1 cDNA ORF Clone, Human, N-Myc tag HG11102-NM
    IL18R1 qPCR Primer Pairs, Human HP101017
    info info
    添加购物车成功! 添加购物车失败!