Quick Order

Canine IL18R1 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Canine IL18R1 cDNA Clone Product Information
NCBI RefSeq:XM_005625993.1
RefSeq ORF Size:1620bp
cDNA Description:Full length Clone DNA of Canis lupus familiaris interleukin 18 receptor 1.
Gene Synonym:IL18R1
Species:Canine
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Interleukin-18 receptor 1 (IL18R1) also known as CD218 antigen-like family member A, CDw218a, IL1 receptor-related protein and CD218a, is an interleukin receptor of the immunoglobulin superfamily. IL18R1 is found expressed in lung, leukocytes, spleen, liver, thymus, prostate, small intestine, colon, placenta, and heart, and is absent from brain, skeletal muscle, pancreas, and kidney. High level of expression is found in Hodgkin disease cell lines. This receptor is specifically binds interleukin 18 (IL18), and is essential for IL18 mediated signal transduction. IL18R1 contains 3 Ig-like C2-type (immunoglobulin-like) domains and 1 TIR domain. It is a single-pass type I membrane protein. IFN-alpha and IL12 are reported to induce the expression of this receptor in NK and T cells. The increased expression of IL18R1 may contribute pathogenically to disease and is therefore a potential therapeutic target. The absence of a genetic association in the IL18R1 gene itself suggests regulation from other parts of the genome, or as part of the inflammatory cascade in multiple sclerosis without a prime genetic cause.

References
  • Nadif R, et al.. (2006) IL18 and IL18R1 polymorphisms, lung CT and fibrosis: A longitudinal study in coal miners. Eur Respir J. 28(6): 1100-5.
  • Haralambieva IH, et al.. (2011) Common SNPs/haplotypes in IL18R1 and IL18 genes are associated with variations in hum oral immunity to smallpox vaccination in Caucasians and African Americans. J Infect Dis. 204(3): 433-41.
  • Hulin-Curtis SL, et al.. (2012) Evaluation of IL18 and IL18R1 polymorphisms: genetic susceptibility to knee osteoarthritis. Int J Immunogenet. 39(2): 106-9.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"