GM2A cDNA ORF Clone, Canine, C-DDK (Flag®) tag

Cat: DG70177-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All GM2A Reagents
CRO Services
Product recommended

All GM2A Reagents
GM2A cDNA ORF Clone, Canine, C-DDK (Flag®) tag General Information
Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
591 bp
Description
Full length Clone DNA of Canine GM2 ganglioside activator with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GM2A Background Information

GM2A (GM2 ganglioside activator), is a lipid transfer protein which belongs to the ML domain family. GM2A can accommodate several single chain phospholipids and fatty acids. It also exhibits some calcium-independent phospholipase activity. GM2A binds gangliosides and stimulates ganglioside GM2 degradation. It stimulates only the breakdown of ganglioside GM2 and glycolipid GA2 by beta-hexosaminidase A. GM2A acts as a substrate specific co-factor for the lysosomal enzyme β-hexosaminidase A. β-hexosaminidase A, together with GM2 ganglioside activator, catalyzes the degradation of the ganglioside GM2, and other molecules containing terminal N-acetyl hexosamines. It extracts single GM2 molecules from membranes and presents them in soluble form to beta-hexosaminidase A for cleavage of N-acetyl-D-galactosamine and conversion to GM3. Defects in GM2A are the cause of GM2-gangliosidosis type AB (GM2GAB), also known as Tay-Sachs disease AB variant.

Full Name
GM2 ganglioside activator
References
  • Wright CS, et al. (2003) Structural analysis of lipid complexes of GM2-activator protein. J Mol Biol. 331(4):951-64.
  • GM2A cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    GM2A cDNA ORF Clone in Cloning Vector, Canine DG70177-U
    GM2A cDNA ORF Clone, Canine, untagged DG70177-UT
    GM2A cDNA ORF Clone, Canine, C-GFPSpark® tag DG70177-ACG
    GM2A Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70177-ACGLN
    GM2A cDNA ORF Clone, Canine, C-OFPSpark® tag DG70177-ACR
    GM2A cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70177-NF
    GM2A cDNA ORF Clone, Canine, C-His tag DG70177-CH
    GM2A cDNA ORF Clone, Canine, N-His tag DG70177-NH
    GM2A cDNA ORF Clone, Canine, C-HA tag DG70177-CY
    GM2A cDNA ORF Clone, Canine, N-HA tag DG70177-NY
    GM2A cDNA ORF Clone, Canine, C-Myc tag DG70177-CM
    GM2A cDNA ORF Clone, Canine, N-Myc tag DG70177-NM

    GM2A cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    GM2A cDNA ORF Clone in Cloning Vector, Mouse MG59762-U
    GM2A cDNA ORF Clone, Mouse, untagged MG59762-UT
    GM2A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59762-ACGLN
    GM2A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59762-ACG
    GM2A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG59762-ACR
    GM2A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG59762-CF
    GM2A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG59762-NF
    GM2A cDNA ORF Clone, Mouse, C-His tag MG59762-CH
    GM2A cDNA ORF Clone, Mouse, N-His tag MG59762-NH
    GM2A cDNA ORF Clone, Mouse, C-HA tag MG59762-CY
    GM2A cDNA ORF Clone, Mouse, N-HA tag MG59762-NY
    GM2A cDNA ORF Clone, Mouse, C-Myc tag MG59762-CM
    GM2A cDNA ORF Clone, Mouse, N-Myc tag MG59762-NM

    GM2A cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    GM2A cDNA ORF Clone in Cloning Vector, Human HG13246-G
    GM2A cDNA ORF Clone, Human, untagged HG13246-UT
    GM2A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13246-ACGLN
    GM2A cDNA ORF Clone, Human, C-GFPSpark® tag HG13246-ACG
    GM2A cDNA ORF Clone, Human, C-OFPSpark® tag HG13246-ACR
    GM2A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13246-CF
    GM2A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13246-NF
    GM2A cDNA ORF Clone, Human, C-His tag HG13246-CH
    GM2A cDNA ORF Clone, Human, N-His tag HG13246-NH
    GM2A cDNA ORF Clone, Human, C-HA tag HG13246-CY
    GM2A cDNA ORF Clone, Human, N-HA tag HG13246-NY
    GM2A cDNA ORF Clone, Human, C-Myc tag HG13246-CM
    GM2A cDNA ORF Clone, Human, N-Myc tag HG13246-NM
    GM2A qPCR Primer Pairs, Human HP101956
    info info
    添加购物车成功! 添加购物车失败!