Quick Order

Canine GM2A Gene ORF cDNA clone expression plasmid, C-Flag tag

DatasheetReviewsRelated ProductsProtocols
Canine GM2A cDNA Clone Product Information
NCBI RefSeq:XM_003639011.2
RefSeq ORF Size:591bp
cDNA Description:Full length Clone DNA of Canis lupus familiaris GM2 ganglioside activator with C terminal Flag tag.
Gene Synonym:GM2A
Species:Canine
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

GM2A (GM2 ganglioside activator), is a lipid transfer protein which belongs to the ML domain family. GM2A can accommodate several single chain phospholipids and fatty acids. It also exhibits some calcium-independent phospholipase activity. GM2A binds gangliosides and stimulates ganglioside GM2 degradation. It stimulates only the breakdown of ganglioside GM2 and glycolipid GA2 by beta-hexosaminidase A. GM2A acts as a substrate specific co-factor for the lysosomal enzyme β-hexosaminidase A. β-hexosaminidase A, together with GM2 ganglioside activator, catalyzes the degradation of the ganglioside GM2, and other molecules containing terminal N-acetyl hexosamines. It extracts single GM2 molecules from membranes and presents them in soluble form to beta-hexosaminidase A for cleavage of N-acetyl-D-galactosamine and conversion to GM3. Defects in GM2A are the cause of GM2-gangliosidosis type AB (GM2GAB), also known as Tay-Sachs disease AB variant.

References
  • Wright CS, et al. (2003) Structural analysis of lipid complexes of GM2-activator protein. J Mol Biol. 331(4):951-64.
  • Size / Price
    Catalog: DG70177-CF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"