GFR alpha-1 cDNA ORF Clone, Canine, C-DDK (Flag®) tag

Cat: DG70062-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All GFR alpha-1 Reagents
CRO Services
Product recommended

All GFR alpha-1 Reagents
GFR alpha-1 cDNA ORF Clone, Canine, C-DDK (Flag®) tag General Information
Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
1407 bp
Description
Full length Clone DNA of Canine GDNF family receptor alpha 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GFR alpha-1 Background Information

Glial cell line derived neurotrophic factor (GDNF) Family Receptor Alpha 1 (GFRA1) is a member of the GDNF receptor family. It is a glycosylphosphatidylinositol (GPI)-linked cell surface receptor for both GDNF and NTN, and mediates activation of the RET tyrosine kinase receptor. GFRA1 is a potent survival factor for central and peripheral neurons, and is essential for the development of kidneys and the enteric nervous system. Glial cell line-derived neurotrophic factor (GDNF) and neurturin (NTN) are its binding ligand which are two structurally related, potent neurotrophic factors that play key roles in the control of neuron survival and differentiation. GDNF promotes the formation of a physical complex between GFRA/GDNFRa and the orphan tyrosin kinase receptor Ret, thereby inducing its tyrosine phosphorylation. The RET is a receptor tyrosine kinase representing the signal-transducing molecule of a multisubunit surface receptor complex for the GDNF, in which GFRA / GDNFRa acts as the ligand-binding component. GDNF, a distantly related member of the transforming growth factor-β (TGF-â) superfamily, and its receptor components: GFRA1, Ret and neural cell adhesion molecule (NCAM) have been recently reported to be expressed in the testis and to be involved in the proliferation regulation of immature Sertoli cells.

Full Name
GDNF family receptor alpha 1
References
  • Jing S, et al. (1997) GFRalpha-2 and GFRalpha-3 are two new receptors for ligands of the GDNF family. J Biol Chem. 272(52): 33111-7.
  • Jing S, et al. (1996) GDNF-induced activation of the ret protein tyrosine kinase is mediated by GDNFR-alpha, a novel receptor for GDNF. Cell. 85(7):1113-24.
  • Treanor JJ, et al. (1996) Characterization of a multicomponent receptor for GDNF. Nature. 382(6586): 80-3.
  • GFR alpha-1 cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    GFR alpha-1 cDNA ORF Clone in Cloning Vector, Canine DG70062-G
    GFR alpha-1 cDNA ORF Clone, Canine, untagged DG70062-UT
    GFR alpha-1 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70062-ACGLN
    GFR alpha-1 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70062-ACG
    GFR alpha-1 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70062-ACR
    GFR alpha-1 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70062-NF
    GFR alpha-1 cDNA ORF Clone, Canine, C-His tag DG70062-CH
    GFR alpha-1 cDNA ORF Clone, Canine, N-His tag DG70062-NH
    GFR alpha-1 cDNA ORF Clone, Canine, C-HA tag DG70062-CY
    GFR alpha-1 cDNA ORF Clone, Canine, N-HA tag DG70062-NY
    GFR alpha-1 cDNA ORF Clone, Canine, C-Myc tag DG70062-CM
    GFR alpha-1 cDNA ORF Clone, Canine, N-Myc tag DG70062-NM

    GFR alpha-1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    GFR alpha-1 cDNA ORF Clone in Cloning Vector, Rat RG80021-M
    GFR alpha-1 cDNA ORF Clone, Rat, untagged RG80021-UT
    GFR alpha-1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80021-ACG
    GFR alpha-1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80021-ACGLN
    GFR alpha-1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80021-ACR
    GFR alpha-1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80021-CF
    GFR alpha-1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80021-NF
    GFR alpha-1 cDNA ORF Clone, Rat, C-His tag RG80021-CH
    GFR alpha-1 cDNA ORF Clone, Rat, N-His tag RG80021-NH
    GFR alpha-1 cDNA ORF Clone, Rat, C-HA tag RG80021-CY
    GFR alpha-1 cDNA ORF Clone, Rat, N-HA tag RG80021-NY
    GFR alpha-1 cDNA ORF Clone, Rat, C-Myc tag RG80021-CM
    GFR alpha-1 cDNA ORF Clone, Rat, N-Myc tag RG80021-NM
    GFR alpha-1 qPCR Primer Pairs, Rat RP300020

    GFR alpha-1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    GFR alpha-1 cDNA ORF Clone in Cloning Vector, Mouse MG50171-U
    GFR alpha-1 cDNA ORF Clone, Mouse, untagged MG50171-UT
    GFR alpha-1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50171-ACG
    GFR alpha-1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50171-ACGLN
    GFR alpha-1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50171-ACR
    GFR alpha-1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50171-CF
    GFR alpha-1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50171-NF
    GFR alpha-1 cDNA ORF Clone, Mouse, C-His tag MG50171-CH
    GFR alpha-1 cDNA ORF Clone, Mouse, N-His tag MG50171-NH
    GFR alpha-1 cDNA ORF Clone, Mouse, C-HA tag MG50171-CY
    GFR alpha-1 cDNA ORF Clone, Mouse, N-HA tag MG50171-NY
    GFR alpha-1 cDNA ORF Clone, Mouse, C-Myc tag MG50171-CM
    GFR alpha-1 cDNA ORF Clone, Mouse, N-Myc tag MG50171-NM
    GFR alpha-1 qPCR Primer Pairs, Mouse MP200201

    GFR alpha-1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    GFR alpha-1 cDNA ORF Clone in Cloning Vector, Human HG10330-M
    GFR alpha-1 cDNA ORF Clone, Human, untagged HG10330-UT
    GFR alpha-1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10330-ACGLN
    GFR alpha-1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10330-ACG
    GFR alpha-1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10330-ACR
    GFR alpha-1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10330-CF
    GFR alpha-1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10330-NF
    GFR alpha-1 cDNA ORF Clone, Human, C-His tag HG10330-CH
    GFR alpha-1 cDNA ORF Clone, Human, N-His tag HG10330-NH
    GFR alpha-1 cDNA ORF Clone, Human, C-HA tag HG10330-CY
    GFR alpha-1 cDNA ORF Clone, Human, N-HA tag HG10330-NY
    GFR alpha-1 cDNA ORF Clone, Human, C-Myc tag HG10330-CM
    GFR alpha-1 cDNA ORF Clone, Human, N-Myc tag HG10330-NM
    GFR alpha-1 qPCR Primer Pairs, Human HP100370
    info info
    添加购物车成功! 添加购物车失败!