Quick Order

Canine GFRA1 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Canine GFRA1 cDNA Clone Product Information
NCBI RefSeq:XM_846994.2
RefSeq ORF Size:1407bp
cDNA Description:Full length Clone DNA of Canis lupus familiaris GDNF family receptor alpha 1.
Gene Synonym:GFRA1
Species:Canine
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Glial cell line derived neurotrophic factor (GDNF) Family Receptor Alpha 1 (GFRA1) is a member of the GDNF receptor family. It is a glycosylphosphatidylinositol (GPI)-linked cell surface receptor for both GDNF and NTN, and mediates activation of the RET tyrosine kinase receptor. GFRA1 is a potent survival factor for central and peripheral neurons, and is essential for the development of kidneys and the enteric nervous system. Glial cell line-derived neurotrophic factor (GDNF) and neurturin (NTN) are its binding ligand which are two structurally related, potent neurotrophic factors that play key roles in the control of neuron survival and differentiation. GDNF promotes the formation of a physical complex between GFRA/GDNFRa and the orphan tyrosin kinase receptor Ret, thereby inducing its tyrosine phosphorylation. The RET is a receptor tyrosine kinase representing the signal-transducing molecule of a multisubunit surface receptor complex for the GDNF, in which GFRA / GDNFRa acts as the ligand-binding component. GDNF, a distantly related member of the transforming growth factor-β (TGF-â) superfamily, and its receptor components: GFRA1, Ret and neural cell adhesion molecule (NCAM) have been recently reported to be expressed in the testis and to be involved in the proliferation regulation of immature Sertoli cells.

References
  • Jing S, et al. (1997) GFRalpha-2 and GFRalpha-3 are two new receptors for ligands of the GDNF family. J Biol Chem. 272(52): 33111-7.
  • Jing S, et al. (1996) GDNF-induced activation of the ret protein tyrosine kinase is mediated by GDNFR-alpha, a novel receptor for GDNF. Cell. 85(7):1113-24.
  • Treanor JJ, et al. (1996) Characterization of a multicomponent receptor for GDNF. Nature. 382(6586): 80-3.
  • Size / Price
    Catalog: DG70062-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"