GDPD2 cDNA ORF Clone, Canine, untagged

Cat: DG70185-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All GDPD2 Reagents
CRO Services
Product recommended

All GDPD2 Reagents
GDPD2 cDNA ORF Clone, Canine, untagged General Information
Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
1626 bp
Description
Full length Clone DNA of Canine glycerophosphodiester phosphodiesterase domain containing 2.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GDPD2 Background Information
Full Name
glycerophosphodiester phosphodiesterase domain containing 2

GDPD2 cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
GDPD2 cDNA ORF Clone in Cloning Vector, Canine DG70185-U
GDPD2 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70185-ACGLN
GDPD2 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70185-ACG
GDPD2 cDNA ORF Clone, Canine, N-GFPSpark® tag DG70185-ANG
GDPD2 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70185-ACR
GDPD2 cDNA ORF Clone, Canine, N-OFPSpark® tag DG70185-ANR
GDPD2 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70185-CF
GDPD2 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70185-NF
GDPD2 cDNA ORF Clone, Canine, C-His tag DG70185-CH
GDPD2 cDNA ORF Clone, Canine, N-His tag DG70185-NH
GDPD2 cDNA ORF Clone, Canine, C-HA tag DG70185-CY
GDPD2 cDNA ORF Clone, Canine, N-HA tag DG70185-NY
GDPD2 cDNA ORF Clone, Canine, C-Myc tag DG70185-CM
GDPD2 cDNA ORF Clone, Canine, N-Myc tag DG70185-NM

GDPD2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
GDPD2 cDNA ORF Clone in Cloning Vector, Rat RG81026-U
GDPD2 cDNA ORF Clone, Rat, untagged RG81026-UT
GDPD2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81026-ACGLN
GDPD2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81026-ACG
GDPD2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81026-ACR
GDPD2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81026-CF
GDPD2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81026-NF
GDPD2 cDNA ORF Clone, Rat, C-His tag RG81026-CH
GDPD2 cDNA ORF Clone, Rat, N-His tag RG81026-NH
GDPD2 cDNA ORF Clone, Rat, C-HA tag RG81026-CY
GDPD2 cDNA ORF Clone, Rat, N-HA tag RG81026-NY
GDPD2 cDNA ORF Clone, Rat, C-Myc tag RG81026-CM
GDPD2 cDNA ORF Clone, Rat, N-Myc tag RG81026-NM
GDPD2 qPCR Primer Pairs, Rat RP300990

GDPD2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GDPD2 cDNA ORF Clone in Cloning Vector, Human HG14850-G
GDPD2 cDNA ORF Clone, Human, untagged HG14850-UT
GDPD2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14850-ACGLN
GDPD2 cDNA ORF Clone, Human, C-GFPSpark® tag HG14850-ACG
GDPD2 cDNA ORF Clone, Human, C-OFPSpark® tag HG14850-ACR
GDPD2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14850-CF
GDPD2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14850-NF
GDPD2 cDNA ORF Clone, Human, C-His tag HG14850-CH
GDPD2 cDNA ORF Clone, Human, N-His tag HG14850-NH
GDPD2 cDNA ORF Clone, Human, C-HA tag HG14850-CY
GDPD2 cDNA ORF Clone, Human, N-HA tag HG14850-NY
GDPD2 cDNA ORF Clone, Human, C-Myc tag HG14850-CM
GDPD2 cDNA ORF Clone, Human, N-Myc tag HG14850-NM
GDPD2 qPCR Primer Pairs, Human HP103481
info info
添加购物车成功! 添加购物车失败!