GDF-9 cDNA ORF Clone, Canine, C-DDK (Flag®) tag

Cat: DG70054-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All GDF-9 Reagents
CRO Services
Product recommended

All GDF-9 Reagents
GDF-9 cDNA ORF Clone, Canine, C-DDK (Flag®) tag General Information
Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
1344 bp
Description
Full length Clone DNA of Canine growth differentiation factor 9 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GDF-9 Background Information
Full Name
growth differentiation factor 9

GDF-9 cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
GDF-9 cDNA ORF Clone in Cloning Vector, Canine DG70054-G
GDF-9 cDNA ORF Clone, Canine, untagged DG70054-UT
GDF-9 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70054-ACGLN
GDF-9 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70054-ACG
GDF-9 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70054-ACR
GDF-9 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70054-NF
GDF-9 cDNA ORF Clone, Canine, C-His tag DG70054-CH
GDF-9 cDNA ORF Clone, Canine, N-His tag DG70054-NH
GDF-9 cDNA ORF Clone, Canine, C-HA tag DG70054-CY
GDF-9 cDNA ORF Clone, Canine, N-HA tag DG70054-NY
GDF-9 cDNA ORF Clone, Canine, C-Myc tag DG70054-CM
GDF-9 cDNA ORF Clone, Canine, N-Myc tag DG70054-NM

GDF-9 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
GDF-9 cDNA ORF Clone, Mouse, untagged MG57822-UT
GDF-9 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57822-ACG
GDF-9 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57822-ACGLN
GDF-9 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG57822-ACR
GDF-9 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG57822-CF
GDF-9 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG57822-NF
GDF-9 cDNA ORF Clone, Mouse, C-His tag MG57822-CH
GDF-9 cDNA ORF Clone, Mouse, N-His tag MG57822-NH
GDF-9 cDNA ORF Clone, Mouse, C-HA tag MG57822-CY
GDF-9 cDNA ORF Clone, Mouse, N-HA tag MG57822-NY
GDF-9 cDNA ORF Clone, Mouse, C-Myc tag MG57822-CM
GDF-9 cDNA ORF Clone, Mouse, N-Myc tag MG57822-NM

GDF-9 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GDF-9 cDNA ORF Clone in Cloning Vector, Human HG10938-M
GDF-9 cDNA ORF Clone, Human, untagged HG10938-UT
GDF-9 cDNA ORF Clone, Human, C-GFPSpark® tag HG10938-ACG
GDF-9 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10938-ACGLN
GDF-9 cDNA ORF Clone, Human, C-OFPSpark® tag HG10938-ACR
GDF-9 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10938-CF
GDF-9 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10938-NF
GDF-9 cDNA ORF Clone, Human, C-His tag HG10938-CH
GDF-9 cDNA ORF Clone, Human, N-His tag HG10938-NH
GDF-9 cDNA ORF Clone, Human, C-HA tag HG10938-CY
GDF-9 cDNA ORF Clone, Human, N-HA tag HG10938-NY
GDF-9 cDNA ORF Clone, Human, C-Myc tag HG10938-CM
GDF-9 cDNA ORF Clone, Human, N-Myc tag HG10938-NM
GDF-9 qPCR Primer Pairs, Human HP100817
info info
添加购物车成功! 添加购物车失败!