Quick Order

Canine GDF15/MIC-1 Gene ORF cDNA clone expression plasmid

    DatasheetReviewsRelated ProductsProtocols
    Canine GDF15 cDNA Clone Product Information
    NCBI RefSeq:XM_541938.1
    RefSeq ORF Size:924bp
    cDNA Description:Full length Clone DNA of Canis lupus familiaris growth differentiation factor 15.
    Gene Synonym:GDF15
    Species:Canine
    Vector:pCMV3-untagged
    Plasmid:
    Restriction Site:
    Tag Sequence:
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Product nameProduct name
    Background

    Growth-differentiation factor 15 (GDF15), also known as MIC-1, is a secreted member of the transforming growth factor (TGF)-β superfamily, as a novel antihypertrophic regulatory factor in the heart. GDF-15 / GDF15 is not expressed in the normal adult heart but is induced in response to conditions that promote hypertrophy and dilated cardiomyopathy and it is expressed highly in liver. GDF-15 / GDF15 has a role in regulating inflammatory and apoptotic pathways in injured tissues and during disease processes. GDF-15 / GDF15 is synthesized as precursor molecules that are processed at a dibasic cleavage site to release C-terminal domains containing a characteristic motif of 7 conserved cysteines in the mature protein. GDF-15 / GDF15 overexpression arising from an expanded erythroid compartment contributes to iron overload in thalassemia syndromes by inhibiting hepcidin expression.

    References
  • Ago T, et al. (2006) GDF15, a cardioprotective TGF-beta superfamily protein. Circ Res. 98 (3): 294-297.
  • Hsiao E, et al. (2000) Characterization of growth-differentiation factor 15, a transforming growth factor beta superfamily member induced following liver injury. Mol Cell Biol. 20 (10): 3742-51.
  • Zimmers T, et al. (2005) Growth differentiation factor-15/macrophage inhibitory cytokine-1 induction after kidney and lung injury. Shock. 23 (6): 543-8.
  • Size / Price
    Catalog: DG70050-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"