FGF18 cDNA ORF Clone, Canine, C-DDK (Flag®) tag

Cat: DG70059-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All FGF18 Reagents
CRO Services
Product recommended

All FGF18 Reagents
FGF18 cDNA ORF Clone, Canine, C-DDK (Flag®) tag General Information
Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
624 bp
Description
Full length Clone DNA of Canine fibroblast growth factor 18 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FGF18 Background Information

Fibroblast growth factor 18 (FGF18) is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth, and invasion. It has been shown in vitro that FGF18 is able to induce neurite outgrowth in PC12 cells. Studies of the similar proteins in mouse and chick suggested that this protein is a pleiotropic growth factor that stimulates proliferation in a number of tissues, most notably the liver and small intestine. Experiment datas identified FGF18 as a selective ligand for FGFR3 in limb bud mesenchymal cells, which suppressed proliferation and promoted their differentiation and production of cartilage matrix. FGF18 appears to regulate cell proliferation and differentiation positively in osteogenesis and negatively in chondrogenesis.

Full Name
fibroblast growth factor 18
References
  • Ohbayashi N, et al. (2002) FGF18 is required for normal cell proliferation and differentiation during osteogenesis and chondrogenesis. Genes Dev. 16(7): 870-9.
  • Davidson D, et al. (2005) Fibroblast growth factor (FGF) 18 signals through FGF receptor 3 to promote chondrogenesis. J Biol Chem. 280(21): 20509-15.
  • Liu Z, et al. (2007) FGF18 is required for early chondrocyte proliferation, hypertrophy and vascular invasion of the growth plate. Dev Biol. 302(1): 80-91.
  • FGF18 cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    FGF18 cDNA ORF Clone in Cloning Vector, Canine DG70059-G
    FGF18 cDNA ORF Clone, Canine, untagged DG70059-UT
    FGF18 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70059-ACGLN
    FGF18 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70059-ACG
    FGF18 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70059-ACR
    FGF18 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70059-NF
    FGF18 cDNA ORF Clone, Canine, C-His tag DG70059-CH
    FGF18 cDNA ORF Clone, Canine, N-His tag DG70059-NH
    FGF18 cDNA ORF Clone, Canine, C-HA tag DG70059-CY
    FGF18 cDNA ORF Clone, Canine, N-HA tag DG70059-NY
    FGF18 cDNA ORF Clone, Canine, C-Myc tag DG70059-CM
    FGF18 cDNA ORF Clone, Canine, N-Myc tag DG70059-NM

    FGF18 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    FGF18 cDNA ORF Clone in Cloning Vector, Mouse MG50177-M
    FGF18 cDNA ORF Clone, Mouse, untagged MG50177-UT
    FGF18 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50177-ACG
    FGF18 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50177-ACGLN
    FGF18 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50177-ACR
    FGF18 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50177-CF
    FGF18 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50177-NF
    FGF18 cDNA ORF Clone, Mouse, C-His tag MG50177-CH
    FGF18 cDNA ORF Clone, Mouse, N-His tag MG50177-NH
    FGF18 cDNA ORF Clone, Mouse, C-HA tag MG50177-CY
    FGF18 cDNA ORF Clone, Mouse, N-HA tag MG50177-NY
    FGF18 cDNA ORF Clone, Mouse, C-Myc tag MG50177-CM
    FGF18 cDNA ORF Clone, Mouse, N-Myc tag MG50177-NM
    FGF18 qPCR Primer Pairs, Mouse MP200207

    FGF18 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    FGF18 cDNA ORF Clone in Cloning Vector, Human HG13206-G
    FGF18 cDNA ORF Clone, Human, untagged HG13206-UT
    FGF18 cDNA ORF Clone, Human, C-GFPSpark® tag HG13206-ACG
    FGF18 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13206-ACGLN
    FGF18 cDNA ORF Clone, Human, C-OFPSpark® tag HG13206-ACR
    FGF18 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13206-CF
    FGF18 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13206-NF
    FGF18 cDNA ORF Clone, Human, C-His tag HG13206-CH
    FGF18 cDNA ORF Clone, Human, N-His tag HG13206-NH
    FGF18 cDNA ORF Clone, Human, C-HA tag HG13206-CY
    FGF18 cDNA ORF Clone, Human, N-HA tag HG13206-NY
    FGF18 cDNA ORF Clone, Human, C-Myc tag HG13206-CM
    FGF18 cDNA ORF Clone, Human, N-Myc tag HG13206-NM
    FGF18 qPCR Primer Pairs, Human HP101880
    info info
    添加购物车成功! 添加购物车失败!