Quick Order

Canine FGF14/SCA27 Gene ORF cDNA clone expression plasmid, C-Flag tag

DatasheetReviewsRelated ProductsProtocols
Canine FGF14 cDNA Clone Product Information
NCBI RefSeq:XM_003433069.1
RefSeq ORF Size:759bp
cDNA Description:Full length Clone DNA of Canis lupus familiaris fibroblast growth factor 14 with C terminal Flag tag.
Gene Synonym:FGF14
Species:Canine
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

FGF14 is a member of the fibroblast growth factor (FGF) family. Members of this family possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. FGF14 is probably involved in nervous system development and function. Defects in FGF14 are the cause of spinocerebellar ataxia type 27 (SCA27). It is a clinically and genetically heterogeneous group of cerebellar disorders. Patients show progressive incoordination of gait and often poor coordination of hands, speech and eye movements, due to degeneration of the cerebellum with variable involvement of the brainstem and spinal cord. SCA27 is an autosomal dominant cerebellar ataxia. It is a slowly progressive disorder, with onset in late-childhood to early adulthood, characterized by ataxia with tremor, orofacial dyskinesia, psychiatric symptoms and cognitive deficits.

References
  • Wang Q, et al. (2002) Ataxia and paroxysmal dyskinesia in mice lacking axonally transported FGF14. Neuron. 35 (1): 25-38.
  • Zhao Y, et al. (2007) Genetic analysis of SCA 27 in ataxia and childhood onset postural tremor. Am J Med Genet. 144B (3): 395-6.
  • Lou JY, et al. (2005) Fibroblast growth factor 14 is an intracellular modulator of voltage-gated sodium channels. J Physiol. 569 (1): 179-93.
  • Size / Price
    Catalog: DG70046-CF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"