CXCL16 cDNA ORF Clone, Canine, C-DDK (Flag®) tag

Cat: DG70060-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CXCL16 Reagents
CRO Services
Product recommended

All CXCL16 Reagents
CXCL16 cDNA ORF Clone, Canine, C-DDK (Flag®) tag General Information
Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
768 bp
Description
Full length Clone DNA of Canine chemokine (C-X-C motif) ligand 16 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CXCL16 Background Information

C-X-C motif chemokine 16, also known as Small-inducible cytokine B16, SR-PSOX, and CXCL16, is a single-pass type I membrane protein which belongs to the intercrine alpha (chemokine CxC) family. CXCL16 exists in transmembrane and soluble forms. The transmembrane form acts as a scavenger receptor for oxidised LDL whereas the soluble form acts a chemoattractant for mainly CD8+ T cells. CXCL16 is a protein which shares pattern recognition receptor functions, relevant for adhesion and phagocytosis of bacterial products, with the properties of an adhesion molecule and inflammatory chemokine. CXCL16/SR-PSOX is an interferon-gamma-regulated chemokine and scavenger receptor for oxidized low-density lipoprotein that is expressed in atherosclerotic lesions. Proteolytic cleavage of membrane-bound CXCL16 releases soluble CXCL16, which may promote migration of effector T cells and augment a proatherogenic inflammatory response. CXCL16/SR-PSOX can be a potential player in atherogenesis. Enhanced expression of CXCL16 has been demonstrated in atherosclerotic plaques and several properties have been attributed to CXCL16 that could influence the atherosclerotic process. Following in vitro studies suggested that as an adhesion molecule CXCL16/SR-PSOX might mediate T-cell adhesion to the endothelium, as a chemokine-drive T-cell migration, stimulate cell proliferation and elicit inflammatory phenotype in smooth muscle cells (SMC) and, finally, as a scavenger receptor-mediate uptake of atherogenic lipoproteins by macrophages and SMC. CXCR6 and its ligand CXCL16 in regulating metastasis and invasion of cancer. CXCR6 and CXCL16 are up-regulated in multiple cancer tissue types and cancer cell lines relative to normal tissues and cell lines. In addition, both CXCR6 and CXCL16 levels increase as tumor malignancy increases. Thus, CXCL16 and CXCR6 may mark cancers arising in an inflammatory milieu and mediate pro-tumorigenic effects of inflammation through direct effects on cancer cell growth and by inducing the migration and proliferation of tumor-associated leukocytes.

Full Name
chemokine (C-X-C motif) ligand 16
References
  • Sheikine Y, et al. (2008) CXCL16/SR-PSOX--a friend or a foe in atherosclerosis? Atherosclerosis. 197(2): 487-95.
  • Lehrke M, et al. (2008) CXCL16 is a surrogate marker of inflammatory bowel disease. Scand J Gastroenterol. 43(3): 283-8.
  • Jansson AM, et al. (2009) Soluble CXCL16 predicts long-term mortality in acute coronary syndromes. Circulation. 119(25): 3181-8.
  • Darash-Yahana M, et al. (2009) The chemokine CXCL16 and its receptor, CXCR6, as markers and promoters of inflammation-associated cancers. PLoS One. 4(8): e6695.
  • Deng L, et al. (2010) CXCR6/CXCL16 functions as a regulator in metastasis and progression of cancer. Biochim Biophys Acta. 1806(1): 42-9.
  • CXCL16 cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    CXCL16 cDNA ORF Clone in Cloning Vector, Canine DG70060-G
    CXCL16 cDNA ORF Clone, Canine, untagged DG70060-UT
    CXCL16 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70060-ACGLN
    CXCL16 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70060-ACG
    CXCL16 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70060-ACR
    CXCL16 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70060-NF
    CXCL16 cDNA ORF Clone, Canine, C-His tag DG70060-CH
    CXCL16 cDNA ORF Clone, Canine, N-His tag DG70060-NH
    CXCL16 cDNA ORF Clone, Canine, C-HA tag DG70060-CY
    CXCL16 cDNA ORF Clone, Canine, N-HA tag DG70060-NY
    CXCL16 cDNA ORF Clone, Canine, C-Myc tag DG70060-CM
    CXCL16 cDNA ORF Clone, Canine, N-Myc tag DG70060-NM

    CXCL16 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CXCL16 cDNA ORF Clone in Cloning Vector, Rat RG80149-G
    CXCL16 cDNA ORF Clone, Rat, untagged RG80149-UT
    CXCL16 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80149-ACG
    CXCL16 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80149-ACGLN
    CXCL16 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80149-ACR
    CXCL16 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80149-CF
    CXCL16 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80149-NF
    CXCL16 cDNA ORF Clone, Rat, C-His tag RG80149-CH
    CXCL16 cDNA ORF Clone, Rat, N-His tag RG80149-NH
    CXCL16 cDNA ORF Clone, Rat, C-HA tag RG80149-CY
    CXCL16 cDNA ORF Clone, Rat, N-HA tag RG80149-NY
    CXCL16 cDNA ORF Clone, Rat, C-Myc tag RG80149-CM
    CXCL16 cDNA ORF Clone, Rat, N-Myc tag RG80149-NM
    CXCL16 qPCR Primer Pairs, Rat RP300144

    CXCL16 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CXCL16 cDNA ORF Clone in Cloning Vector, Mouse MG50142-M
    CXCL16 cDNA ORF Clone, Mouse, untagged MG50142-UT
    CXCL16 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50142-ACG
    CXCL16 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50142-ACGLN
    CXCL16 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50142-ACR
    CXCL16 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50142-CF
    CXCL16 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50142-NF
    CXCL16 cDNA ORF Clone, Mouse, C-His tag MG50142-CH
    CXCL16 cDNA ORF Clone, Mouse, N-His tag MG50142-NH
    CXCL16 cDNA ORF Clone, Mouse, C-HA tag MG50142-CY
    CXCL16 cDNA ORF Clone, Mouse, N-HA tag MG50142-NY
    CXCL16 cDNA ORF Clone, Mouse, C-Myc tag MG50142-CM
    CXCL16 cDNA ORF Clone, Mouse, N-Myc tag MG50142-NM
    CXCL16 qPCR Primer Pairs, Mouse MP200172

    CXCL16 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CXCL16 cDNA ORF Clone in Cloning Vector, Human HG10834-M
    CXCL16 cDNA ORF Clone, Human, untagged HG10834-UT
    CXCL16 cDNA ORF Clone, Human, C-GFPSpark® tag HG10834-ACG
    CXCL16 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10834-ACGLN
    CXCL16 cDNA ORF Clone, Human, C-OFPSpark® tag HG10834-ACR
    CXCL16 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10834-CF
    CXCL16 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10834-NF
    CXCL16 cDNA ORF Clone, Human, C-His tag HG10834-CH
    CXCL16 cDNA ORF Clone, Human, N-His tag HG10834-NH
    CXCL16 cDNA ORF Clone, Human, C-HA tag HG10834-CY
    CXCL16 cDNA ORF Clone, Human, N-HA tag HG10834-NY
    CXCL16 cDNA ORF Clone, Human, C-Myc tag HG10834-CM
    CXCL16 cDNA ORF Clone, Human, N-Myc tag HG10834-NM
    CXCL16 qPCR Primer Pairs, Human HP100733
    info info
    添加购物车成功! 添加购物车失败!