Text Size:AAA

Canine SDF-1/CXCL12 Gene ORF cDNA clone expression plasmid, N-HA tag

    DatasheetReviewsRelated ProductsProtocols
    Canine CXCL12 cDNA Clone Product Information
    NCBI RefSeq:NM_001128097.1
    RefSeq ORF Size:282bp
    cDNA Description:Full length Clone DNA of Canis lupus familiaris chemokine (C-X-C motif) ligand 12 with N terminal HA tag.
    Gene Synonym:SDF1, CXCL12
    Species:Canine
    Vector:pCMV3-SP-N-HA
    Plasmid:
    Restriction Site:
    Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Product nameProduct name
    Background

    The human stromal cell-derived factor-1 (SDF1), also known as CXCL12, is a small (8 kDa) cytokine highly conserved chemotactic cytokine belonging to the large family of CXC chemokines. SDF1 is expressed in two isoforms from a single gene that encodes two splice variants, SDF1α and SDF1β, which are identical except for the four residues present in the C-terminus of SDF1β but absent from SDF1α. The chemokine CXCL12 [stromal cell-derived factor-1 (SDF-1)] binds primarily to CXC receptor 4 (CXCR4; CD184). The binding of CXCL12 to CXCR4 induces intracellular signaling through several divergent pathways initiating signals related to chemotaxis, cell survival and/or proliferation, increase in intracellular calcium, and gene transcription. CXCL12 and CXCR4 that have been widely characterized in peripheral tissues and delineate their main functions in the CNS. Extensive evidence supports CXCL12 as a key regulator for early development of the CNS. In the mature CNS, CXCL12 modulates neurotransmission, neurotoxicity and neuroglial interactions. CXCL12 has crucial roles in the formation of multiple organ systems during embryogenesis and in the regulation of bone marrow haematopoiesis and immune function in the postnatal organism. Although considered an important factor in normal bone metabolism, recent studies implicate CXCL12 in the pathogenesis of several diseases involving the skeleton, including rheumatoid arthritis and cancers that metastasize to bone. The CXCL12/CXCR4 axis is involved in tumor progression, angiogenesis, metastasis, and survival. Pathologically enhanced CXCL12 signaling may promote the formation of new vessels through recruiting circulating endothelial progenitor cells or directly enhancing the migration/growth of endothelial cells. Therefore, CXCL12 signaling represents an important mechanism that regulates brain tumor angiogenesis/vasculogenesis and may provide potential targets for anti-angiogenic therapy in malignant gliomas.

    References
  • Bleul, C.C. et al., 1996, Nature. 382: 829-833.
  • Sapede, D. et al., 2005, Proc. Natl. Acad. Sci. USA. 102: 1714-1718.
  • Delgado, M.B. et al., 2001, Eur. J. Immunol. 31: 699-707.
  • Orimo, A. et al., 2005, Cell. 121: 335-348.
  • Kryczek, I. et al., 2007, Am. J. Physiol. Cell. Physiol. 292: C987-995.
  • Bbalabanian, K. et al., 2005, J. Biol. Chem. 280: 35760-35766.
  • Size / Price
    Catalog: DG70055-NY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"