Quick Order

Canine Fractalkine/CX3CL1 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Canine CX3CL1 cDNA Clone Product Information
NCBI RefSeq:AB648939.1
RefSeq ORF Size:1314bp
cDNA Description:Full length Clone DNA of Canis lupus familiaris chemokine (C-X3-C motif) ligand 1.
Gene Synonym:CX3CL1
Species:Canine
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Fractalkine or Chemokine (C-X3-C motif) ligand 1 (CX3CL1) is a member of the CX3C chemokine family. Fractalkine / CX3CL1 is a unique chemokine that functions not only as a chemoattractant but also as an adhesion molecule and is expressed on endothelial cells activated by proinflammatory cytokines, such as interferon-gamma and tumor necrosis factor-alpha. Fractalkine/CX3CL1 is expressed in a membrane-bound form on activated endothelial cells and mediates attachment and firm adhesion of T cells, monocytes and NK cells. Fractalkine / CX3CL1 is associated with dendritic cells (DC) in epidermis and lymphoid organs. The fractalkine receptor, CX3CR1, is expressed on cytotoxic effector lymphocytes, including natural killer (NK) cells and cytotoxic T lymphocytes, which contain high levels of intracellular perforin and granzyme B, and on macrophages. Soluble fractalkine causes migration of NK cells, cytotoxic T lymphocytes, and macrophages, whereas the membrane-bound form captures and enhances the subsequent migration of these cells in response to secondary stimulation with other chemokines.

References
  • Imai T, et al. (1997) Identification and molecular characterization of fractalkine receptor CX3CR1, which mediates both leukocyte migration and adhesion. Cell. 91(4): 521-30.
  • Papadopoulos EJ, et al. (1999) Fractalkine, a CX3C chemokine, is expressed by dendritic cells and is up-regulated upon dendritic cell maturation. Eur J Immunol. 29 (8): 2551-9.
  • Umehara H, et al. (2004) Fractalkine in vascular biology: from basic research to clinical disease". Arterioscler. Thromb Vasc Biol. 24 (1): 34-40.
  • Size / Price
    Catalog: DG70071-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"