UMP / CMP kinase cDNA ORF Clone, Canine, C-His tag

Cat: DG70228-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All UMP / CMP kinase Reagents
CRO Services
Product recommended

All UMP / CMP kinase Reagents
UMP / CMP kinase cDNA ORF Clone, Canine, C-His tag General Information
Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
687 bp
Description
Full length Clone DNA of Canine cytidine monophosphate (UMP-CMP) kinase 1, cytosolic with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

UMP / CMP kinase Background Information

CMPK1 plays a key role in the maintenance of pyrimidine nucleotide pool profile and for the metabolism of pyrimidine analogs in cells. It catalyzes the phosphoryl transfer from ATP to UMP, CMP, and deoxy-CMP (dCMP), resulting in the formation of ADP and the corresponding nucleoside diphosphate. CMPK1 also has a significant role in the activation of pyrimidine analogs, which are clinically useful anti-cancer and anti-viral drugs. In the meanwhile, CMPK1 functions in cellular nucleic acid biosynthesis.

Full Name
cytidine monophosphate (UMP-CMP) kinase 1, cytosolic
References
  • Liou J, et al. (2004) Phosphorylation of Cytidine, Deoxycytidine, and Their Analog Monophosphates by Human UMP/CMP Kinase is Differentially Regulated by ATP and Magnesium. Molecular Pharmacology. 67(3):806-14.
  • Gerhard DS, et al. (2004) The Status, Quality, and Expansion of the NIH Full-Length cDNA Project: The Mammalian Gene Collection (MGC). Genome Research. 14(10B):2121-7.
  • Segura-Pena D, et al. (2004) Substrate-induced Conformational Changes in Human UMP/CMP Kinase. Journal of Biological Chemistry. 279(32):33882-9.
  • UMP / CMP kinase cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    UMP / CMP kinase cDNA ORF Clone in Cloning Vector, Canine DG70228-U
    UMP / CMP kinase cDNA ORF Clone, Canine, untagged DG70228-UT
    UMP / CMP kinase cDNA ORF Clone, Canine, C-GFPSpark® tag DG70228-ACG
    UMP / CMP kinase Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70228-ACGLN
    UMP / CMP kinase cDNA ORF Clone, Canine, N-GFPSpark® tag DG70228-ANG
    UMP / CMP kinase cDNA ORF Clone, Canine, C-OFPSpark® tag DG70228-ACR
    UMP / CMP kinase cDNA ORF Clone, Canine, N-OFPSpark® tag DG70228-ANR
    UMP / CMP kinase cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70228-CF
    UMP / CMP kinase cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70228-NF
    UMP / CMP kinase cDNA ORF Clone, Canine, N-His tag DG70228-NH
    UMP / CMP kinase cDNA ORF Clone, Canine, C-HA tag DG70228-CY
    UMP / CMP kinase cDNA ORF Clone, Canine, N-HA tag DG70228-NY
    UMP / CMP kinase cDNA ORF Clone, Canine, C-Myc tag DG70228-CM
    UMP / CMP kinase cDNA ORF Clone, Canine, N-Myc tag DG70228-NM

    UMP / CMP kinase cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    UMP / CMP kinase cDNA ORF Clone in Cloning Vector, Rat RG81090-U
    UMP / CMP kinase cDNA ORF Clone, Rat, untagged RG81090-UT
    UMP / CMP kinase cDNA ORF Clone, Rat, C-GFPSpark® tag RG81090-ACG
    UMP / CMP kinase Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81090-ACGLN
    UMP / CMP kinase cDNA ORF Clone, Rat, N-GFPSpark® tag RG81090-ANG
    UMP / CMP kinase cDNA ORF Clone, Rat, C-OFPSpark® tag RG81090-ACR
    UMP / CMP kinase cDNA ORF Clone, Rat, N-OFPSpark® tag RG81090-ANR
    UMP / CMP kinase cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81090-CF
    UMP / CMP kinase cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81090-NF
    UMP / CMP kinase cDNA ORF Clone, Rat, C-His tag RG81090-CH
    UMP / CMP kinase cDNA ORF Clone, Rat, N-His tag RG81090-NH
    UMP / CMP kinase cDNA ORF Clone, Rat, C-HA tag RG81090-CY
    UMP / CMP kinase cDNA ORF Clone, Rat, N-HA tag RG81090-NY
    UMP / CMP kinase cDNA ORF Clone, Rat, C-Myc tag RG81090-CM
    UMP / CMP kinase cDNA ORF Clone, Rat, N-Myc tag RG81090-NM
    UMP / CMP kinase qPCR Primer Pairs, Rat RP301047

    UMP / CMP kinase cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    UMP / CMP kinase cDNA ORF Clone in Cloning Vector, Mouse MG5A5239-U
    UMP / CMP kinase cDNA ORF Clone, Mouse, untagged MG5A5239-UT
    UMP / CMP kinase Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A5239-ACGLN
    UMP / CMP kinase cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A5239-ACG
    UMP / CMP kinase cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A5239-ANG
    UMP / CMP kinase cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A5239-ACR
    UMP / CMP kinase cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A5239-ANR
    UMP / CMP kinase cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A5239-CF
    UMP / CMP kinase cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A5239-NF
    UMP / CMP kinase cDNA ORF Clone, Mouse, C-His tag MG5A5239-CH
    UMP / CMP kinase cDNA ORF Clone, Mouse, N-His tag MG5A5239-NH
    UMP / CMP kinase cDNA ORF Clone, Mouse, C-HA tag MG5A5239-CY
    UMP / CMP kinase cDNA ORF Clone, Mouse, N-HA tag MG5A5239-NY
    UMP / CMP kinase cDNA ORF Clone, Mouse, C-Myc tag MG5A5239-CM
    UMP / CMP kinase cDNA ORF Clone, Mouse, N-Myc tag MG5A5239-NM

    UMP / CMP kinase cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    UMP / CMP kinase cDNA ORF Clone in Cloning Vector, Human HG14258-G
    UMP / CMP kinase cDNA ORF Clone, Human, untagged HG14258-UT
    UMP / CMP kinase cDNA ORF Clone, Human, C-GFPSpark® tag HG14258-ACG
    UMP / CMP kinase Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14258-ACGLN
    UMP / CMP kinase cDNA ORF Clone, Human, N-GFPSpark® tag HG14258-ANG
    UMP / CMP kinase cDNA ORF Clone, Human, C-OFPSpark® tag HG14258-ACR
    UMP / CMP kinase cDNA ORF Clone, Human, N-OFPSpark® tag HG14258-ANR
    UMP / CMP kinase cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14258-CF
    UMP / CMP kinase cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14258-NF
    UMP / CMP kinase cDNA ORF Clone, Human, C-His tag HG14258-CH
    UMP / CMP kinase cDNA ORF Clone, Human, N-His tag HG14258-NH
    UMP / CMP kinase cDNA ORF Clone, Human, C-HA tag HG14258-CY
    UMP / CMP kinase cDNA ORF Clone, Human, N-HA tag HG14258-NY
    UMP / CMP kinase cDNA ORF Clone, Human, C-Myc tag HG14258-CM
    UMP / CMP kinase cDNA ORF Clone, Human, N-Myc tag HG14258-NM
    UMP / CMP kinase qPCR Primer Pairs, Human HP102908
    info info
    添加购物车成功! 添加购物车失败!