CD40 Ligand cDNA ORF Clone, Canine, untagged

Cat: DG70068-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CD40 Ligand Reagents
CRO Services
Product recommended

All CD40 Ligand Reagents
CD40 Ligand cDNA ORF Clone, Canine, untagged General Information
Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
783 bp
Description
Full length Clone DNA of Canine CD40 ligand.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD40 Ligand Background Information

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD154, also known as CD40 ligand or CD40L, is a member of the TNF superfamily. While CD154 was originally found on T cell surface, its expression has since been found on a wide variety of cells, including platelets, mast cells, macrophages and NK cells. CD154's ability is achieved through binding to the CD40 on antigen- presenting cells (APC). In the macrophage cells, the primary signal for activation is IFN-γ from Th1 type CD4 T cells. The secondary signal is CD40L on the T cell, which interacting with the CD40 molecules, helping increase the level of activation.

Immune Checkpoint
Immune Checkpoint Detection: Antibodies   Immune Checkpoint Detection: ELISA Antibodies   Immune Checkpoint Detection: WB Antibodies
Immune Checkpoint Proteins
Immune Checkpoint Targets   Co-stimulatory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
CD40 ligand
Research Areas
References
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Grewal IS, et al. (1998) CD40 and CD154 in cell-mediated immunity. Annual Review of Immunology. 16: 111-35.
  • CD40 Ligand cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    CD40 Ligand cDNA ORF Clone in Cloning Vector, Canine DG70068-G
    CD40 Ligand Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70068-ACGLN
    CD40 Ligand cDNA ORF Clone, Canine, C-GFPSpark® tag DG70068-ACG
    CD40 Ligand cDNA ORF Clone, Canine, C-OFPSpark® tag DG70068-ACR
    CD40 Ligand cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70068-CF
    CD40 Ligand cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70068-NF
    CD40 Ligand cDNA ORF Clone, Canine, C-His tag DG70068-CH
    CD40 Ligand cDNA ORF Clone, Canine, N-His tag DG70068-NH
    CD40 Ligand cDNA ORF Clone, Canine, C-HA tag DG70068-CY
    CD40 Ligand cDNA ORF Clone, Canine, N-HA tag DG70068-NY
    CD40 Ligand cDNA ORF Clone, Canine, C-Myc tag DG70068-CM
    CD40 Ligand cDNA ORF Clone, Canine, N-Myc tag DG70068-NM

    CD40 Ligand cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    CD40 Ligand cDNA ORF Clone in Cloning Vector, Rhesus CG90096-G
    CD40 Ligand cDNA ORF Clone, Rhesus, untagged CG90096-UT
    CD40 Ligand cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90096-ACG
    CD40 Ligand Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90096-ACGLN
    CD40 Ligand cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90096-ACR
    CD40 Ligand cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90096-CF
    CD40 Ligand cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90096-NF
    CD40 Ligand cDNA ORF Clone, Rhesus, C-His tag CG90096-CH
    CD40 Ligand cDNA ORF Clone, Rhesus, N-His tag CG90096-NH
    CD40 Ligand cDNA ORF Clone, Rhesus, C-HA tag CG90096-CY
    CD40 Ligand cDNA ORF Clone, Rhesus, N-HA tag CG90096-NY
    CD40 Ligand cDNA ORF Clone, Rhesus, C-Myc tag CG90096-CM
    CD40 Ligand cDNA ORF Clone, Rhesus, N-Myc tag CG90096-NM

    CD40 Ligand cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD40 Ligand cDNA ORF Clone in Cloning Vector, Mouse MG50327-G
    CD40 Ligand cDNA ORF Clone, Mouse, untagged MG50327-UT
    CD40 Ligand Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50327-ACGLN
    CD40 Ligand cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50327-ACG
    CD40 Ligand cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50327-ACR
    CD40 Ligand cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50327-CF
    CD40 Ligand cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50327-NF
    CD40 Ligand cDNA ORF Clone, Mouse, C-His tag MG50327-CH
    CD40 Ligand cDNA ORF Clone, Mouse, N-His tag MG50327-NH
    CD40 Ligand cDNA ORF Clone, Mouse, C-HA tag MG50327-CY
    CD40 Ligand cDNA ORF Clone, Mouse, N-HA tag MG50327-NY
    CD40 Ligand cDNA ORF Clone, Mouse, C-Myc tag MG50327-CM
    CD40 Ligand cDNA ORF Clone, Mouse, N-Myc tag MG50327-NM
    CD40 Ligand qPCR Primer Pairs, Mouse MP200350

    CD40 Ligand cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CD40 Ligand cDNA ORF Clone in Cloning Vector, Human HG10239-G
    CD40 Ligand cDNA ORF Clone, Human, untagged HG10239-UT
    CD40 Ligand Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10239-ACGLN
    CD40 Ligand cDNA ORF Clone, Human, C-GFPSpark® tag HG10239-ACG
    CD40 Ligand cDNA ORF Clone, Human, C-OFPSpark® tag HG10239-ACR
    CD40 Ligand cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10239-CF
    CD40 Ligand cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10239-NF
    CD40 Ligand cDNA ORF Clone, Human, C-His tag HG10239-CH
    CD40 Ligand cDNA ORF Clone, Human, N-His tag HG10239-NH
    CD40 Ligand cDNA ORF Clone, Human, C-HA tag HG10239-CY
    CD40 Ligand cDNA ORF Clone, Human, N-HA tag HG10239-NY
    CD40 Ligand cDNA ORF Clone, Human, C-Myc tag HG10239-CM
    CD40 Ligand cDNA ORF Clone, Human, N-Myc tag HG10239-NM
    CD40 Ligand qPCR Primer Pairs, Human HP100289

    CD40 Ligand cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CD40 Ligand qPCR Primer Pairs, Rat RP300146
    info info
    添加购物车成功! 添加购物车失败!