CD27 cDNA ORF Clone, Canine, untagged

Cat: DG70092-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CD27 Reagents
CRO Services
Product recommended

All CD27 Reagents
CD27 cDNA ORF Clone, Canine, untagged General Information
Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
816 bp
Description
Full length Clone DNA of Canine CD27 molecule.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD27 Background Information

CD27, also known as TNFRSF7, is a member of the TNF-receptor superfamily limited to cells of the lymphoid lineage, and exists as both a dimeric glycoprotein on the cell surface and as a soluble protein in serum. As a type I transmembrane glycoprotein of about 55 kDa existing as disulfide-linked homodimer, CD27 has been shown to play roles in lymphoid proliferation, differentiation, and apoptosis.It has important role in generation of T cell immunity, and is an apparently robust marker for normal memory B cells. It is a T and B cell co-stimulatory molecule, the activity of CD27 is governed by its TNF-like ligand CD70 on lymphocytes and dendritic cells. The CD27-CD70 interaction is required for Th1 generation responses to differentiation signals and long-term maintenance of T cell immunity, and meanwhile, plays a key role in regulating B-cell differentiation, activation and immunoglobulin synthesis.

Immune Checkpoint
Immune Checkpoint Detection: Antibodies   Immune Checkpoint Detection: ELISA Antibodies   Immune Checkpoint Detection: IHC Antibodies   Immune Checkpoint Detection: ICC Antibodies   Immune Checkpoint Detection: FCM Antibodies
Immune Checkpoint Proteins
Immune Checkpoint Targets   Co-stimulatory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
CD27 molecule
Research Areas
References
  • Drner T, et al. (2004) Correlation of circulating CD27 high plasma cells and disease activity in systemic lupus erythematosus. Lupus. 13(5): 283-9.
  • Sahota SS, et al. (2009) CD27 in defining memory B-cell origins in Waldenstrm's macroglobulinemia. Clin Lymphoma Myeloma. 9(1): 33-5.
  • Jiang J, et al. (2010) Reduced CD27 expression on antigen-specific CD4+ T cells correlates with persistent active tuberculosis. J Clin Immunol. 30(4): 566-73.
  • CD27 cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    CD27 cDNA ORF Clone in Cloning Vector, Canine DG70092-G
    CD27 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70092-ACGLN
    CD27 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70092-ACG
    CD27 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70092-ACR
    CD27 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70092-CF
    CD27 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70092-NF
    CD27 cDNA ORF Clone, Canine, C-His tag DG70092-CH
    CD27 cDNA ORF Clone, Canine, N-His tag DG70092-NH
    CD27 cDNA ORF Clone, Canine, C-HA tag DG70092-CY
    CD27 cDNA ORF Clone, Canine, N-HA tag DG70092-NY
    CD27 cDNA ORF Clone, Canine, C-Myc tag DG70092-CM
    CD27 cDNA ORF Clone, Canine, N-Myc tag DG70092-NM

    CD27 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    CD27 cDNA ORF Clone in Cloning Vector, Rhesus CG90049-G
    CD27 cDNA ORF Clone, Rhesus, untagged CG90049-UT
    CD27 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90049-ACG
    CD27 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90049-ACGLN
    CD27 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90049-ACR
    CD27 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90049-G-F
    CD27 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90049-CF
    CD27 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90049-NF
    CD27 cDNA ORF Clone, Rhesus, C-His tag CG90049-CH
    CD27 cDNA ORF Clone, Rhesus, N-His tag CG90049-NH
    CD27 cDNA ORF Clone, Rhesus, C-HA tag CG90049-CY
    CD27 cDNA ORF Clone, Rhesus, N-HA tag CG90049-NY
    CD27 cDNA ORF Clone, Rhesus, C-Myc tag CG90049-CM
    CD27 cDNA ORF Clone, Rhesus, N-Myc tag CG90049-NM

    CD27 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CD27 cDNA ORF Clone in Cloning Vector, Rat RG80223-G
    CD27 cDNA ORF Clone, Rat, untagged RG80223-UT
    CD27 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80223-ACGLN
    CD27 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80223-ACG
    CD27 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80223-ACR
    CD27 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80223-CF
    CD27 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80223-NF
    CD27 cDNA ORF Clone, Rat, C-His tag RG80223-CH
    CD27 cDNA ORF Clone, Rat, N-His tag RG80223-NH
    CD27 cDNA ORF Clone, Rat, C-HA tag RG80223-CY
    CD27 cDNA ORF Clone, Rat, N-HA tag RG80223-NY
    CD27 cDNA ORF Clone, Rat, C-Myc tag RG80223-CM
    CD27 cDNA ORF Clone, Rat, N-Myc tag RG80223-NM
    CD27 qPCR Primer Pairs, Rat RP300153

    CD27 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD27 cDNA ORF Clone in Cloning Vector, Mouse MG50110-M
    CD27 cDNA ORF Clone, Mouse, untagged MG50110-UT
    CD27 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50110-ACGLN
    CD27 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50110-ACG
    CD27 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50110-ACR
    CD27 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50110-CF
    CD27 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50110-NF
    CD27 cDNA ORF Clone, Mouse, C-His tag MG50110-CH
    CD27 cDNA ORF Clone, Mouse, N-His tag MG50110-NH
    CD27 cDNA ORF Clone, Mouse, C-HA tag MG50110-CY
    CD27 cDNA ORF Clone, Mouse, N-HA tag MG50110-NY
    CD27 cDNA ORF Clone, Mouse, C-Myc tag MG50110-CM
    CD27 cDNA ORF Clone, Mouse, N-Myc tag MG50110-NM
    CD27 qPCR Primer Pairs, Mouse MP200140

    CD27 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CD27 cDNA ORF Clone in Cloning Vector, Human HG10039-M
    CD27 cDNA ORF Clone, Human, untagged HG10039-UT
    CD27 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10039-ACGLN
    CD27 cDNA ORF Clone, Human, C-GFPSpark® tag HG10039-ACG
    CD27 cDNA ORF Clone, Human, C-OFPSpark® tag HG10039-ACR
    CD27 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10039-CF
    CD27 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10039-NF
    CD27 cDNA ORF Clone, Human, C-His tag HG10039-CH
    CD27 cDNA ORF Clone, Human, N-His tag HG10039-NH
    CD27 cDNA ORF Clone, Human, C-HA tag HG10039-CY
    CD27 cDNA ORF Clone, Human, N-HA tag HG10039-NY
    CD27 cDNA ORF Clone, Human, C-Myc tag HG10039-CM
    CD27 cDNA ORF Clone, Human, N-Myc tag HG10039-NM
    CD27 qPCR Primer Pairs, Human HP100132
    info info
    添加购物车成功! 添加购物车失败!