CCL25/TECK cDNA ORF Clone, Canine, C-DDK (Flag®) tag

Cat: DG70058-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CCL25/TECK Reagents
CRO Services
Product recommended

All CCL25/TECK Reagents
CCL25/TECK cDNA ORF Clone, Canine, C-DDK (Flag®) tag General Information
Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
456 bp
Description
Full length Clone DNA of Canine chemokine (C-C motif) ligand 25 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CCL25/TECK Background Information
Full Name
chemokine (C-C motif) ligand 25

CCL25/TECK cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
CCL25/TECK cDNA ORF Clone in Cloning Vector, Canine DG70058-G
CCL25/TECK cDNA ORF Clone, Canine, untagged DG70058-UT
CCL25/TECK cDNA ORF Clone, Canine, C-GFPSpark® tag DG70058-ACG
CCL25/TECK Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70058-ACGLN
CCL25/TECK cDNA ORF Clone, Canine, C-OFPSpark® tag DG70058-ACR
CCL25/TECK cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70058-NF
CCL25/TECK cDNA ORF Clone, Canine, C-His tag DG70058-CH
CCL25/TECK cDNA ORF Clone, Canine, N-His tag DG70058-NH
CCL25/TECK cDNA ORF Clone, Canine, C-HA tag DG70058-CY
CCL25/TECK cDNA ORF Clone, Canine, N-HA tag DG70058-NY
CCL25/TECK cDNA ORF Clone, Canine, C-Myc tag DG70058-CM
CCL25/TECK cDNA ORF Clone, Canine, N-Myc tag DG70058-NM

CCL25/TECK cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
CCL25/TECK cDNA ORF Clone in Cloning Vector, Rhesus CG90139-G
CCL25/TECK cDNA ORF Clone, Rhesus, untagged CG90139-UT
CCL25/TECK cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90139-ACG
CCL25/TECK Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90139-ACGLN
CCL25/TECK cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90139-ACR
CCL25/TECK cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90139-CF
CCL25/TECK cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90139-NF
CCL25/TECK cDNA ORF Clone, Rhesus, C-His tag CG90139-CH
CCL25/TECK cDNA ORF Clone, Rhesus, N-His tag CG90139-NH
CCL25/TECK cDNA ORF Clone, Rhesus, C-HA tag CG90139-CY
CCL25/TECK cDNA ORF Clone, Rhesus, N-HA tag CG90139-NY
CCL25/TECK cDNA ORF Clone, Rhesus, C-Myc tag CG90139-CM
CCL25/TECK cDNA ORF Clone, Rhesus, N-Myc tag CG90139-NM

CCL25/TECK cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CCL25/TECK cDNA ORF Clone in Cloning Vector, Mouse MG50109-M
CCL25/TECK cDNA ORF Clone, Mouse, untagged MG50109-UT
CCL25/TECK cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50109-ACG
CCL25/TECK Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50109-ACGLN
CCL25/TECK cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50109-ACR
CCL25/TECK cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50109-CF
CCL25/TECK cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50109-NF
CCL25/TECK cDNA ORF Clone, Mouse, C-His tag MG50109-CH
CCL25/TECK cDNA ORF Clone, Mouse, N-His tag MG50109-NH
CCL25/TECK cDNA ORF Clone, Mouse, C-HA tag MG50109-CY
CCL25/TECK cDNA ORF Clone, Mouse, N-HA tag MG50109-NY
CCL25/TECK cDNA ORF Clone, Mouse, C-Myc tag MG50109-CM
CCL25/TECK cDNA ORF Clone, Mouse, N-Myc tag MG50109-NM
CCL25/TECK qPCR Primer Pairs, Mouse MP200139

CCL25/TECK cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CCL25/TECK cDNA ORF Clone in Cloning Vector, Human HG10601-M
CCL25/TECK cDNA ORF Clone, Human, untagged HG10601-UT
CCL25/TECK cDNA ORF Clone, Human, C-GFPSpark® tag HG10601-ACG
CCL25/TECK Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10601-ACGLN
CCL25/TECK cDNA ORF Clone, Human, C-OFPSpark® tag HG10601-ACR
CCL25/TECK cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10601-CF
CCL25/TECK cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10601-NF
CCL25/TECK cDNA ORF Clone, Human, C-His tag HG10601-CH
CCL25/TECK cDNA ORF Clone, Human, N-His tag HG10601-NH
CCL25/TECK cDNA ORF Clone, Human, C-HA tag HG10601-CY
CCL25/TECK cDNA ORF Clone, Human, N-HA tag HG10601-NY
CCL25/TECK cDNA ORF Clone, Human, C-Myc tag HG10601-CM
CCL25/TECK cDNA ORF Clone, Human, N-Myc tag HG10601-NM
CCL25/TECK qPCR Primer Pairs, Human HP100591
info info
添加购物车成功! 添加购物车失败!