After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Canine BMP-2 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Canine BMP2 cDNA Clone Product Information
NCBI RefSeq:XM_534351.3
RefSeq ORF Size:1188bp
cDNA Description:Full length Clone DNA of Canis lupus familiaris bone morphogenetic protein 2.
Gene Synonym:BMP2
Species:Canine
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

BMP-2 protein, like other bone morphogenetic proteins, plays an important role in the development of bone and cartilage. BMP-2 protein is involved in the hedgehog pathway, TGF beta signaling pathway, and cytokine-cytokine receptor interaction. BMP-2 and BMP-7 are osteogenic BMPs that have been demonstrated to potently induce osteoblast differentiation in a variety of cell types. BMP-2, BMP-4 and BMP-7 are known to be of major importance in bone formation and repair. In cancerous tissues BMP-2 protein may play an important role in the progression of glioma.

References
  • Jiao X, et al. (2007) Heparan sulfate proteoglycans (HSPGs) modulate BMP-2 osteogenic bioactivity in C2C12 cells. J Biol Chem. 282(2):1080-6.
  • Michon F, et al. (2008) BMP-2 and BMP-7 play antagonistic roles in feather induction. Development 135 (16):2797-805.
  • Size / Price
    Catalog: DG70088-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"