BDNF cDNA ORF Clone, Canine, untagged

Cat: DG70029-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All BDNF Reagents
CRO Services
Product recommended

All BDNF Reagents
BDNF cDNA ORF Clone, Canine, untagged General Information
Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
744 bp
Description
Full length Clone DNA of Canine brain-derived neurotrophic factor.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BDNF Background Information

BDNF is a member of the nerve growth factor family. It is highly expressed in hippocampus, amygdala, cerebral cortex and cerebellum. It also can be detected in heart, lung, skeletal muscle, testis, prostate and placenta. BDNF is induced by cortical neurons, and is necessary for survival of striatal neurons in the brain. During development, BDNF promotes the survival and differentiation of selected neuronal populations of the peripheral and central nervous systems. It participates in axonal growth, pathfinding and in the modulation of dendritic growth and morphology. It functions as the major regulator of synaptic transmission and plasticity at adult synapses in many regions of the CNS. The versatility of BDNF is emphasized by its contribution to a range of adaptive neuronal responses including long-term potentiation (LTP), long-term depression (LTD), certain forms of short-term synaptic plasticity, as well as homeostatic regulation of intrinsic neuronal excitability.

Full Name
brain-derived neurotrophic factor
References
  • Zigova T, et al. (1998) Intraventricular administration of BDNF increases the number of newly generated neurons in the adult olfactory bulb. Mol Cell Neurosci. 11(4):234-45.
  • Acheson A, et al. (1995) A BDNF autocrine loop in adult sensory neurons prevents cell death. Nature 374(6521):450-3.
  • Bekinschtein P, et al. (2008) BDNF is essential to promote persistence of long-term memory storage. Proc Natl Acad Sci. 105(7):2711-6.
  • BDNF cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    BDNF cDNA ORF Clone in Cloning Vector, Canine DG70029-G
    BDNF Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70029-ACGLN
    BDNF cDNA ORF Clone, Canine, C-GFPSpark® tag DG70029-ACG
    BDNF cDNA ORF Clone, Canine, C-OFPSpark® tag DG70029-ACR
    BDNF cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70029-CF
    BDNF cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70029-NF
    BDNF cDNA ORF Clone, Canine, C-His tag DG70029-CH
    BDNF cDNA ORF Clone, Canine, N-His tag DG70029-NH
    BDNF cDNA ORF Clone, Canine, C-HA tag DG70029-CY
    BDNF cDNA ORF Clone, Canine, N-HA tag DG70029-NY
    BDNF cDNA ORF Clone, Canine, C-Myc tag DG70029-CM
    BDNF cDNA ORF Clone, Canine, N-Myc tag DG70029-NM

    BDNF cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    BDNF cDNA ORF Clone in Cloning Vector, Mouse MG50240-G
    BDNF cDNA ORF Clone, Mouse, untagged MG50240-UT
    BDNF Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50240-ACGLN
    BDNF cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50240-ACG
    BDNF cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50240-ACR
    BDNF cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50240-CF
    BDNF cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50240-NF
    BDNF cDNA ORF Clone, Mouse, C-His tag MG50240-CH
    BDNF cDNA ORF Clone, Mouse, N-His tag MG50240-NH
    BDNF cDNA ORF Clone, Mouse, C-HA tag MG50240-CY
    BDNF cDNA ORF Clone, Mouse, N-HA tag MG50240-NY
    BDNF cDNA ORF Clone, Mouse, C-Myc tag MG50240-CM
    BDNF cDNA ORF Clone, Mouse, N-Myc tag MG50240-NM
    BDNF qPCR Primer Pairs, Mouse MP200266

    BDNF cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    BDNF cDNA ORF Clone in Cloning Vector, Human HG10068-M
    BDNF cDNA ORF Clone, Human, untagged HG10068-UT
    BDNF cDNA ORF Clone, Human, C-GFPSpark® tag HG10068-ACG
    BDNF Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10068-ACGLN
    BDNF cDNA ORF Clone, Human, N-GFPSpark® tag HG10068-ANG
    BDNF cDNA ORF Clone, Human, C-OFPSpark® tag HG10068-ACR
    BDNF cDNA ORF Clone, Human, N-OFPSpark® tag HG10068-ANR
    BDNF cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10068-CF
    BDNF cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10068-NF
    BDNF cDNA ORF Clone, Human, C-His tag HG10068-CH
    BDNF cDNA ORF Clone, Human, N-His tag HG10068-NH
    BDNF cDNA ORF Clone, Human, C-HA tag HG10068-CY
    BDNF cDNA ORF Clone, Human, N-HA tag HG10068-NY
    BDNF cDNA ORF Clone, Human, C-Myc tag HG10068-CM
    BDNF cDNA ORF Clone, Human, N-Myc tag HG10068-NM
    BDNF qPCR Primer Pairs, Human HP100154
    info info
    添加购物车成功! 添加购物车失败!