AP1S1 cDNA ORF Clone, Canine, C-DDK (Flag®) tag

Cat: DG70179-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All AP1S1 Reagents
CRO Services
Product recommended

All AP1S1 Reagents
AP1S1 cDNA ORF Clone, Canine, C-DDK (Flag®) tag General Information
Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
477 bp
Description
Full length Clone DNA of Canine adaptor-related protein complex 1, sigma 1 subunit with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

AP1S1 Background Information
Full Name
adaptor related protein complex 1 sigma 1 subunit

AP1S1 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
AP1S1 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90354-G
AP1S1 cDNA ORF Clone, Cynomolgus, untagged CG90354-UT
AP1S1 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90354-ACGLN
AP1S1 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90354-ACG
AP1S1 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90354-ANG
AP1S1 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90354-ACR
AP1S1 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90354-ANR
AP1S1 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90354-CF
AP1S1 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90354-NF
AP1S1 cDNA ORF Clone, Cynomolgus, C-His tag CG90354-CH
AP1S1 cDNA ORF Clone, Cynomolgus, N-His tag CG90354-NH
AP1S1 cDNA ORF Clone, Cynomolgus, C-HA tag CG90354-CY
AP1S1 cDNA ORF Clone, Cynomolgus, N-HA tag CG90354-NY
AP1S1 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90354-CM
AP1S1 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90354-NM

AP1S1 cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
AP1S1 cDNA ORF Clone in Cloning Vector, Canine DG70179-U
AP1S1 cDNA ORF Clone, Canine, untagged DG70179-UT
AP1S1 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70179-ACG
AP1S1 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70179-ACGLN
AP1S1 cDNA ORF Clone, Canine, N-GFPSpark® tag DG70179-ANG
AP1S1 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70179-ACR
AP1S1 cDNA ORF Clone, Canine, N-OFPSpark® tag DG70179-ANR
AP1S1 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70179-NF
AP1S1 cDNA ORF Clone, Canine, C-His tag DG70179-CH
AP1S1 cDNA ORF Clone, Canine, N-His tag DG70179-NH
AP1S1 cDNA ORF Clone, Canine, C-HA tag DG70179-CY
AP1S1 cDNA ORF Clone, Canine, N-HA tag DG70179-NY
AP1S1 cDNA ORF Clone, Canine, C-Myc tag DG70179-CM
AP1S1 cDNA ORF Clone, Canine, N-Myc tag DG70179-NM

AP1S1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
AP1S1 cDNA ORF Clone in Cloning Vector, Rat RG81323-G
AP1S1 cDNA ORF Clone, Rat, untagged RG81323-UT
AP1S1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81323-ACGLN
AP1S1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81323-ACG
AP1S1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81323-ACR
AP1S1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81323-CF
AP1S1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81323-NF
AP1S1 cDNA ORF Clone, Rat, C-His tag RG81323-CH
AP1S1 cDNA ORF Clone, Rat, N-His tag RG81323-NH
AP1S1 cDNA ORF Clone, Rat, C-HA tag RG81323-CY
AP1S1 cDNA ORF Clone, Rat, N-HA tag RG81323-NY
AP1S1 cDNA ORF Clone, Rat, C-Myc tag RG81323-CM
AP1S1 cDNA ORF Clone, Rat, N-Myc tag RG81323-NM
AP1S1 qPCR Primer Pairs, Rat RP301294

AP1S1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
AP1S1 cDNA ORF Clone in Cloning Vector, Mouse MG52388-G
AP1S1 cDNA ORF Clone, Mouse, untagged MG52388-UT
AP1S1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52388-ACGLN
AP1S1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52388-ACG
AP1S1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52388-ANG
AP1S1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52388-ACR
AP1S1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52388-ANR
AP1S1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52388-CF
AP1S1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52388-NF
AP1S1 cDNA ORF Clone, Mouse, C-His tag MG52388-CH
AP1S1 cDNA ORF Clone, Mouse, N-His tag MG52388-NH
AP1S1 cDNA ORF Clone, Mouse, C-HA tag MG52388-CY
AP1S1 cDNA ORF Clone, Mouse, N-HA tag MG52388-NY
AP1S1 cDNA ORF Clone, Mouse, C-Myc tag MG52388-CM
AP1S1 cDNA ORF Clone, Mouse, N-Myc tag MG52388-NM
AP1S1 qPCR Primer Pairs, Mouse MP202261

AP1S1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
AP1S1 cDNA ORF Clone in Cloning Vector, Human HG29669-U
AP1S1 cDNA ORF Clone, Human, untagged HG12398-UT
AP1S1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG29669-ACGLN
AP1S1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12398-ACGLN
AP1S1 qPCR Primer Pairs, Human HP104756
info info
添加购物车成功! 添加购物车失败!