ANXA9/annexin A9 cDNA ORF Clone, Canine, C-His tag

Cat: DG70226-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ANXA9/annexin A9 Reagents
CRO Services
Product recommended

All ANXA9/annexin A9 Reagents
ANXA9/annexin A9 cDNA ORF Clone, Canine, C-His tag General Information
Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
1038 bp
Description
Full length Clone DNA of Canine annexin A9 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ANXA9/annexin A9 Background Information
Full Name
annexin A9

ANXA9/annexin A9 cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
ANXA9/annexin A9 cDNA ORF Clone in Cloning Vector, Canine DG70226-U
ANXA9/annexin A9 cDNA ORF Clone, Canine, untagged DG70226-UT
ANXA9/annexin A9 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70226-ACG
ANXA9/annexin A9 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70226-ACGLN
ANXA9/annexin A9 cDNA ORF Clone, Canine, N-GFPSpark® tag DG70226-ANG
ANXA9/annexin A9 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70226-ACR
ANXA9/annexin A9 cDNA ORF Clone, Canine, N-OFPSpark® tag DG70226-ANR
ANXA9/annexin A9 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70226-CF
ANXA9/annexin A9 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70226-NF
ANXA9/annexin A9 cDNA ORF Clone, Canine, N-His tag DG70226-NH
ANXA9/annexin A9 cDNA ORF Clone, Canine, C-HA tag DG70226-CY
ANXA9/annexin A9 cDNA ORF Clone, Canine, N-HA tag DG70226-NY
ANXA9/annexin A9 cDNA ORF Clone, Canine, C-Myc tag DG70226-CM
ANXA9/annexin A9 cDNA ORF Clone, Canine, N-Myc tag DG70226-NM

ANXA9/annexin A9 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ANXA9/annexin A9 cDNA ORF Clone in Cloning Vector, Human HG14731-G
ANXA9/annexin A9 cDNA ORF Clone, Human, untagged HG14731-UT
ANXA9/annexin A9 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14731-ACGLN
ANXA9/annexin A9 cDNA ORF Clone, Human, C-GFPSpark® tag HG14731-ACG
ANXA9/annexin A9 cDNA ORF Clone, Human, N-GFPSpark® tag HG14731-ANG
ANXA9/annexin A9 cDNA ORF Clone, Human, C-OFPSpark® tag HG14731-ACR
ANXA9/annexin A9 cDNA ORF Clone, Human, N-OFPSpark® tag HG14731-ANR
ANXA9/annexin A9 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14731-CF
ANXA9/annexin A9 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14731-NF
ANXA9/annexin A9 cDNA ORF Clone, Human, C-His tag HG14731-CH
ANXA9/annexin A9 cDNA ORF Clone, Human, N-His tag HG14731-NH
ANXA9/annexin A9 cDNA ORF Clone, Human, C-HA tag HG14731-CY
ANXA9/annexin A9 cDNA ORF Clone, Human, N-HA tag HG14731-NY
ANXA9/annexin A9 cDNA ORF Clone, Human, C-Myc tag HG14731-CM
ANXA9/annexin A9 cDNA ORF Clone, Human, N-Myc tag HG14731-NM
ANXA9/annexin A9 qPCR Primer Pairs, Human HP103364
info info
添加购物车成功! 添加购物车失败!