Quick Order

Human IL8Rb/CXCR2 Gene ORF cDNA clone expression plasmid, C-His tag

  • Human CXCR2 Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged
DatasheetReviewsRelated ProductsProtocols
Human IL8Rb/CXCR2 cDNA Clone Product Information
NCBI RefSeq:NM_001557.2
RefSeq ORF Size:1083bp
cDNA Description:Full length Clone DNA of interleukin 8 receptor, beta with His tag.
Gene Synonym:CD182, CXCR2, IL8R2, IL8RA, CMKAR2, CDw128b
Species:Human
Vector:pCMV/hygro-His
Plasmid:pCMV-CXCR2-10his
Restriction Site:KpnI + XhoI (5.5kb + 1.11kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref.ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with CXCR2 qPCR primers for gene expression analysis, HP100702 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human IL8Rb/CXCR2 Gene Plasmid Map
Human CXCR2 Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged
pCMV/hygro-HIs Vector Information
 
Vector Name pCMV/hygro-His
Vector Size 5687bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

Schematic of pCMV/hygro-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"