Quick Order

Human CTSZ / CTSX / Cathepsin Z Gene ORF cDNA clone expression plasmid

    DatasheetReviewsRelated ProductsProtocols
    Human CTSZ cDNA Clone Product Information
    NCBI RefSeq:
    RefSeq ORF Size:
    cDNA Description:
    Gene Synonym:
    Restriction Site:
    Tag Sequence:
    Sequence Description:Identical with the Gene Bank Ref. ID sequence.
    ( We provide with CTSZ qPCR primers for gene expression analysis, HP100229 )
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:
    pCMV/hygro Vector Information
    Vector Name pCMV/hygro
    Vector Size 5657bp
    Vector Type Mammalian Expression Vector
    Expression Method Constiutive ,Stable / Transient
    Promoter CMV
    Antibiotic Resistance Ampicillin
    Selection In Mammalian Cells Hygromycin
    Protein Tag None
    Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

    Schematic of pCMV/hygro Multiple Cloning Sites
    Product nameProduct name

    Cathepsin Z (CTSZ), also known as Cathepsin X or CATX, belongs to the C1 family of lysosomal cysteine proteases. Its gene structure and activity properties show several unique features that distinguish it clearly from other human cysteine proteases. It has a very short pro-region that shows no similarity to those of other cathepsins and a three-residue insertion motif that forms a characteristic ‘mini loop’. Cathepsin Z exhibits mono- and di-peptidase activity at its C-terminus, and in contrast to cathepsin B, it does not act as an endopeptidase. It is restricted to the cells of theimmune system, predominantly monocytes, macrophages and dendritic cells. Cathepsin Z is widely expressed in human tissues, suggesting that this enzyme could be involved in the normal intracellular protein degradation taking place in all cell types. It is capable to cleave regulatory motifs at C-terminus affecting the function of targeted molecules. Cathepsin X may regulate also the maturation of dendritic cells, a process, which is crucial in the initiation of adaptive immunity. Furthermore, higher levels of Cathepsin Z are also found in tumour and immune cells of prostate and gastric carcinomas and inmacrophages of gastric mucosa, especially after infection by Helicobacter pylori. Cathepsin Z is also ubiquitously distributed in cancer cell lines and in primary tumors from different sources, suggesting that this enzyme may participate in tumor progression.

  • Santamara I, et al. (1998) Cathepsin Z, a novel human cysteine proteinase with a short propeptide domain and a unique chromosomal location. J Biol Chem. 273(27): 16816-23.
  • Kos J, et al. (2009) The role of cathepsin X in cell signaling. Cell Adh Migr. 3(2): 164-6.
  • Sevenich L, et al. (2010) Synergistic antitumor effects of combined cathepsin B and cathepsin Z deficiencies on breast cancer progression and metastasis in mice. Proc Natl Acad Sci U S A. 107(6): 2497-502.
  • Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.