After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

DatasheetReviewsRelated ProductsProtocols
Human CTSV/CTSL2 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Human CTSV/CTSL2 Gene Plasmid Map
Human CTSL2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Cathepsin V (CTSV), also known as Cathepsin L2, CTSL2, and CATL2, is a member of the peptidase C1 family. It is predominantly expressed in the thymus and testis. Cathepsin V is also expressed in corneal epithelium, and to a lesser extent in conjuctival epithelium and skin. It is a lysosomal cysteine proteinase that may play an important role in corneal physiology. It has about 75% protein sequence identity to murine cathepsin L. The fold of this enzyme is similar to the fold adopted by other members of the papain superfamily of cysteine proteases. Cathepsin V has been recently described as highly homologous to Cathepsin L and exclusively expressed in human thymus and testis. Cathepsin V is the dominant cysteine protease in cortical human thymic epithelial cells, while Cathepsin L and Cathepsin S seem to be restricted to dendritic and macrophage-like cells. Active Cathepsin V in thymic lysosomal preparations was demonstrated by active-site labeling. Recombinant Cathepsin V was capable of converting Ii into CLIP efficiently, suggesting that it is the protease that controls the generation of alphabeta-CLIP complexes in the human thymus. Cathepsin V is the third elastolytic cysteine protease which exhibits the most potent elastase activity yet described among human proteases and that it is present in atherosclerotic plaque specimens. Cathepsin L2 may play a specialized role in the thymus and testis. Expression analysis of cathepsin L2 in human tumors revealed a widespread expression in colorectal and breast carcinomas but not in normal colon or mammary gland or in peritumoral tissues. Cathepsin L2 was also expressed by colorectal and breast cancer cell lines as well as by some tumors of diverse origin, including ovarian and renal carcinomas.

  • Itoh R, et al. (1999) Genomic organization and chromosomal localization of the human cathepsin L2 gene. DNA Res. 6(2): 137-40.
  • Tolosa E, et al. (2003) Cathepsin V is involved in the degradation of invariant chain in human thymus and is overexpressed in myasthenia gravis. J Clin Invest. 112(4): 517-26.
  • Yasuda Y, et al. (2004) Cathepsin V, a novel and potent elastolytic activity expressed in activated macrophages. J Biol Chem. 279(35): 36761-70.
  • Puzer L, et al. (2008) Cathepsin V, but not cathepsins L, B and K, may release angiostatin-like fragments from plasminogen. Biol Chem. 389(2): 195-200.
  • Contact Us
    • Human CTSL2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Recently Viewed Items
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.