After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human Cathepsin D/CTSD Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human CTSD cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:Human
Vector:
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:
Promoter:
Application:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Shipping_carrier:
Storage:
Human CTSD Gene Plasmid Map
Human CTSD Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

Cathepsin D (CTSD), a well known lysosomal aspartyl protease and belongs to the peptidase C1 family, which is a normal and major component of lysosomes, and is found in almost all cells and tissues of mammals. Its mostly described function is intracellular catabolism in lysosomal compartments, other physiological effect include hormone and antigen processing. Cathepsin D has a specificity similar to but narrower than that of pepsin A. Cathepsin D plays an important role in the degradation of proteins, the generation of bioactive proteins, antigen processing, etc. Among different role in cell physiology, a new function of this enzyme is examined. Cathepsin D is an important regulator of apoptotic pathways in cells. It acts at different stage of intrinsic and extrinsic pathway of apoptosis. In addition, CTSD secreted from human prostate carcinoma cells are responsible for the generation of angiostatin, a potent endogenous inhibitor of angiogenesis, suggesting its contribution to the prevention of tumor growth and angiogenesis-dependent growth of metastases.

References
  • Fusek M, et al. (2005) Dual role of cathepsin D: ligand and protease. Biomed Pap Med Fac Univ Palacky Olomouc Czech Repub. 149(1): 43-50.
  • Minarowska A, et al. (2007) Regulatory role of cathepsin D in apoptosis. Folia Histochem Cytobiol. 45(3): 159-63.
  • Zaidi N, et al. (2008) Cathepsin D: a cellular roadmap. Biochem Biophys Res Commun. 376(1): 5-9.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"