After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human beta-Catenin/CTNNB1 Gene ORF cDNA clone expression plasmid, C-Flag tag

DatasheetReviewsRelated ProductsProtocols
Human CTNNB1 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Human CTNNB1 Gene Plasmid Map
Human CTNNB1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
pCMV/hygro-FLAG Vector Information
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

beta-Catenin, also known as CTNNB1, is a member of the armadillo family of proteins. These proteins have multiple copies of the so-called armadillo repeat domain, which is specialized for protein-protein binding. It is part of a complex of proteins that constitute adherens junctions (AJs). AJs are necessary for the creation and maintenance of epithelial cell layers by regulating cell growth and adhesion between cells. CTNNB1 also anchors the actin cytoskeleton and may be responsible for transmitting the contact inhibition signal that causes cells to stop dividing once the epithelial sheet is complete. Finally, beta-Catenin binds to the product of the APC gene, which is mutated in adenomatous polyposis of the colon. Defects in beta-Catenin can cause colorectal cancer, pilomatrixoma (PTR), medulloblastoma, and ovarian cancer. CTNNB1 is a key dowstream component of the canonical Wnt signaling pathway. In the absence of Wnt, it forms a complex with AXIN1, AXIN2, APC, CSNK1A1 and GSK3B that promotes phosphorylation on N-terminal Ser and Thr residues and ubiquitination of CTNNB1 via BTRC and its subsequent degradation by the proteasome. In the presence of Wnt ligand, beta-Catenin is not ubiquitinated and accumulates in the nucleus, where it acts as a coactivator for transcription factors of the TCF/LEF family, leading to activate Wnt responsive genes. CTNNB1 is involved in the regulation of cell adhesion. The majority of beta-catenin is localized to the cell membrane and is part of E-cadherin/catenin adhesion complexes which are proposed to couple cadherins to the actin cytoskeleton.

  • Yang, et al. (2002) Linking β-catenin to androgen-signaling pathway. J Biol Chem. 277(13):11336-44.
  • Hino S, et al. (2005) Phosphorylation of β-Catenin by Cyclic AMP-Dependent Protein Kinase Stabilizes β-Catenin through Inhibition of Its Ubiquitination. Mol Cell Biol. 25(20):9063-72.
  • Liu X, et al. (2005) Rapid, Wnt-induced changes in GSK3beta associations that regulate beta-catenin stabilization are mediated by Galpha proteins. Curr Biol. 15(22):1989-97.
  • Kraus C, et al. (1994) Localization of the human β-catenin gene (CTNNB1) to 3p21: a region implicated in tumor development. Genomics. 23(1):272-4.
  • Contact Us
    • Human CTNNB1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.