Quick Order

Human CRK natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human CRK cDNA Clone Product Information
NCBI RefSeq:BC008506
RefSeq ORF Size:915bp
cDNA Description:Full length Clone DNA of Homo sapiens v-crk avian sarcoma virus CT10 oncogene homolog.
Gene Synonym:p38, CRKII
Species:Human
Vector:pCMV/hygro
Plasmid:pCMV-CRK
Restriction Site:KpnI + XbaI (5.5kb + 0.92kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human CRK Gene Plasmid Map
Human CRK Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Human CRK natural ORF mammalian expression plasmid on other vectors
Product nameProduct name
Size / Price
Catalog: HG12497-G-N
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock
 Shipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"